Search Strains

ynIs37 [flp-13::GFP] III. juIs223 [ttr-39p::mCherry + ttx-3p::GFP] IV. ttr-39::mCherry alone marks VD and DD neurons. ttx-3::GFP marks AIY neurons. Combined ttr-39::mCherry and flp-13::GFP co-expression marks DD neurons in the L2 (only a few mCherry+/GFP+ DD neurons will show up briefly in the L2 stage and gene silencing apparently dims the GFP marker over time). VD neurons can be identified by mCherry alone, no GFP. Derived by crossing parental strains CZ8332 and NY2037. Can be used to isolate VB neurons by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

wdEx1034 [rab-3p::GFP1-10 + myo-2p::mCherry]. Pick mCherry+ to maintain. wd114 created by the insertion of a tandem array containing seven copies of the GFP11 beta-strand (gfp11x7) in the endogenous oig-1 locus; can be crossed with reporter lines expressing the complementing split GFP fragment (gfp1-10) in specific cell types to facilitate tissue-specific labeling. Reference: He S, et al. Genetics. 2019 Jun;212(2):387-395.

wdEx1086 [myo-3p::GFP1-10 + myo-2p::mCherry]. Pick mCherry+ to maintain. wd116 created by the insertion of a tandem array containing seven copies of the GFP11 beta-strand (gfp11x7) in the endogenous lev-10 locus; can be crossed with reporter lines expressing the complementing split GFP fragment (gfp1-10) in specific cell types to facilitate tissue-specific labeling. Reference: He S, et al. Genetics. 2019 Jun;212(2):387-395.

wdEx1087 [ttr-39p::GFP1-10 + myo-2p::mCherry]. Pick mCherry+ to maintain. wd116 created by the insertion of a tandem array containing seven copies of the GFP11 beta-strand (gfp11x7) in the endogenous lev-10 locus; can be crossed with reporter lines expressing the complementing split GFP fragment (gfp1-10) in specific cell types to facilitate tissue-specific labeling. Reference: He S, et al. Genetics. 2019 Jun;212(2):387-395.

ufIs26 [unc-4p::mCherry + lin-15(+)] II. vsIs13 [lin-11::pes-10::GFP + lin-15(+)] IV. GFP expression in six VC neurons and posterior intestine. VC neurons are labeled with both GFP and mCherry; co-labeling in VCs1-5 is brightest during L4 stage. Derived by crossing parental strains NC2957 and LX959. Can be used to isolate VC neurons by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

ufIs26 [unc-4p::mCherry + lin-15(+)] II. otIs707 [bnc-1p(1.8kb)::GFP]. VB neurons are GFP+ only; VA and SABV have both mCherry and GFP. Can be used to isolate VB neurons by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

ynIs37 [flp-13p::GFP] III. ufIs26 [unc-4p::mCherry + lin-15(+)]. I5 neurons are labeled with GFP and RFP. Can be used to isolate I5 by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

vlcEx1292 [srh-142p::mCherry::SL2::GCaMP3 + unc-122p::RFP]. Maintain at or below 20C; sterile at 25C. Pick animals with RFP+ coelomocytes to maintain. ADF-specific expression of GCaMP3. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334

vlcIs10 [srh-142::mCherry + elt-2::GFP] X. ADF-specific reporter. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334

zdIs13 [tph-1p::GFP] IV. vlcEx1288 [hsp16.2p::lag-1A(cDNA) + ttx-3::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Heatshock induces expression of LAG-1A. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334

zdIs13 [tph-1p::GFP] IV. vlcEx1288 [hsp16.2p::lag-1D(cDNA) + ttx-3::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Heatshock induces expression of LAG-1D. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334

zdIs13 [tph-1p::GFP] IV. vlcEx284 [hsp-16.2p::hlh-3 + ttx-3::mCherry + rol-6(su1006)]. Rollers. Extrachromosomal array containing the heat shock responsive hsp-16.2 promoter for time controlled expression of hlh-3 transcription factor cDNA. Transcriptional tph-1 GFP reporter labels the serotonergic system. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.

vlcEx324 [egl-46p::NLS::DsRed + ttx-3p::mCherry + rol-6(su1006)]. Pick Rollers to maintain. Transcriptional reporter for egl-46 contains NLS::DsRed fused to 4477 bp intergenic DNA. Reference: Lloret-Fernández et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785.

nicIs77 [gst-4p::mCherry] V. Expression of gst-4p::mcherry reporter is strongly induced by oxidative stress. Reference: Jochim B, et al. PLoS Genet. 2025 Jul 7;21(7):e1011780. doi: 10.1371/journal.pgen.1011780. PMID: 40623109.

nicIs146 [skn-1Ap::mCherry::H2B] II. Fluorescent reporter for transcription of skn-1A. Nuclear-localized mCherry expression in most cells. Reference: Jochim B, et al. PLoS Genet. 2025 Jul 7;21(7):e1011780. doi: 10.1371/journal.pgen.1011780. PMID: 40623109.

nicIs148 [skn-1Cp::mCherry::H2B] II. Fluorescent reporter for transcription of skn-1C. Nuclear-localized mCherry expression in most cells. Reference: Jochim B, et al. PLoS Genet. 2025 Jul 7;21(7):e1011780. doi: 10.1371/journal.pgen.1011780. PMID: 40623109.

qyIs127 [lam-1p::lam-1::mCherry + unc-119(+)] V. qyIs166 [cdh-3p::GFP::CAAX + unc-119(+)] X. Temperature-sensitive sterile; maintain at 20C or lower for optimum fertility. Increased sensitivity to RNAi when compared to wild-type animals. lam-1p::lam-1::mCherry expression can be weak and variable. Reference: Kelley, LC, et al. Developmental Cell. 2019 Feb 11;48(3):313-328.e8.

qyIs50 [cdh-3p::moeABD::mCherry + unc-119(+)] V. qyIs550 [zmp-1p::MLS::GFP + unc-119(+)]. Superficially wild-type animals expressing mitochondrial GFP and red F-actin in the anchor cell. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617

qyIs23 [cdh-3p::mCherry::PLCdPH + unc-119(+)] II. lqIs80 [SCMp::GFP::caax] IV. Utse and seam markers. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.

qyIs23 [cdh-3p::mCherry::PLCdPH + unc-119(+)] II. qyIs10 [lam-1p::lam-1::GFP + unc-119(+)] IV. fdgt-1 formerly known as fgt-1. Reference: Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617

qyIs50 [cdh-3p::moeABD::mCherry + unc-119(+)] V. fdgt-1(tm3165) null mutant expressing an anchor cell specific F-actin marker. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617

qyIs50 [cdh-3p::moeABD::mCherry + unc-119(+)] V. qyIs550 [zmp-1p::MLS::GFP + unc-119(+)]. fdgt-1 glucose transporter null mutants (tm3165) expressing anchor cell specific mitochondrial matrix localized GFP and F-actin mCherry. Useful for analyzing mitochondrial localization, morphology and dynamics in the absence of glucose import. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617

qyIs50 [cdh-3p::moeABD::mCherry + unc-119(+)] V. Anchor cell specific red F-actin marker. mNeonGreen tag inserted into C-terminus of endogenous nuo-1 locus. Insertion verified by PCR. Left flanking sequence: 5' CTTTTCTGCATCTCCGGTCAA 3' ; Right flanking sequence: 5' CGTCGTCGTAGAAGATCACAC 3'. sgRNA: 5' GATCTGCTTGGCTCCCTGCT 3'.

qyIs23 [cdh-3p::mCherry::PLCdPH + unc-119(+)] II. lqIs80 [SCMp::GFP::caax] IV. RNAi sensitized strain with utse and seam markers. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.

bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3′ UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3′ UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-31 locus.

bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3′ UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3′ UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-41 locus.

bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3′ UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3′ UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). 2x split GFP tag (GFP11) inserted into the C-terminus of the endogenous sec-61.B locus.

qyIs463 [lin-29p::zif-1::SL2::mCherry]. bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3' UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3' UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). ZF1 and split GFP tag (GFP11) inserted into the C-terminus of the endogenous rpl-31 locus. L4-specific expression of ZIF-1, ubiquitous GFPbeta1-10 and endogenous rpl-31 tagged with ZF-1+GFP-beta11

qyIs46 [emb-9p::emb-9::mCherry + unc-119(+)] X. Superficially wild-type with very low penetrance (~5%) rupture. Integrated collagen::mCherry reporter. Reference: Ihara S, et al. Nat Cell Biol. 2011 Jun;13(6):641-51.

qyIs50 [cdh-3p::moeABD::mCherry + unc-119(+)] V.

qyIs127 [lam-1p::lam-1::mCherry + unc-119(+)] V. Reference: Ihara S, et al. Nat Cell Biol. 2011 Jun;13(6):641-51.

qyIs176 [zmp-1(50-51)p::mCherry::moeABD + unc-119(+)]. Reference: Schindler AJ, Sherwood DR. Dev Biol. 2011 Sep 15;357(2):380-91.

cdIs97 [pcc1::mCherry::cup-5 + ttx-3::GFP + unc-119(+)]. Ballistic transformation. mCherry::CUP-5 expressed in front coelomocyte promoter.

cdIs113 [pcc1::mCherry::rab-5 + ttx-3::GFP + unc-119(+)]. Ballistic transformation. mCherry::RAB-5 expressed in front coelomocyte promoter.

cdIs141[pcc1::mCherry::rab-7 + ttx-3::GFP + unc-119(+)]. Ballistic transformation. mCherry::RAB-7 expressed in front coelomocyte promoter.

qnIs303 [hsp-16.2p::flp-13 + hsp-16.2p::GFP + rab-3p::mCherry] IV. When cultivated at 20 degrees, all animals have red nervous systems. Following heat shock, animals are immobile, do not feed, and show green fluorescence in somatic cells. Reference: Nelson MD, et al. Curr Biol. 2014 Oct 20;24(20):2406-10.

qnIs303 [hsp-16.2p::flp-13 + hsp-16.2p::GFP + rab-3p::mCherry] IV. Pumps and moves 2 hours after heat induced flp-13 over-expression. Outcrossed 1x to NQ570. Reference: Iannacone M, et al. eLife 2017.

jjIs1092 [(pNUT1) npp-1::GFP + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Heterozygotes are wildtype with GFP+ and mCherry+. lpin-1(ok2761) homozygotes die as L1 larvae. Also segregates Unc Rol.

ocfIs2 [pie-1p:mCherry::sp12::pie-1 3'UTR + unc-119(+)]. Stable germline and embryonic expression of ER and NE marker, useful for following NE dynamics through early development. Reference: Joseph-Strauss D, et al. Dev Biol. 2012 May 15;365(2):445-57.

ocfIs5 [pie-1p::mCherry::npp-1::pie-1 3'UTR + unc119(+)]. Reference: Joseph-Strauss D, et al. Dev Biol. 2012 May 15;365(2):445-57.

jjIs1092 [(pNUT1) npp-1::GFP + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Non-Unc.

qaIs3502 [YFP::lmn-1 + CFP::H2B + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Non-Unc.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. qaIs3502[pie-1::YFP::LMN-1 + unc-119(+)].

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. qaIs3546 [pie-1p::GFP::npp-8 + unc-119(+)]; npp-8 is CeNup155.

ltSi597 [knl-1p::knl-1::mCherry::knl-1 3'UTR Cbr-unc-119(+)] I. mCherry labeled KNL-1. Reference: Hattersley et al., Dev Cell 2016 Sep 12;38(5):463-77. doi: 10.1016/j.devcel.2016.08.006. PMID: 27623381

ltIs79 [(pAA196) pie-1p::mCherry::rab-5 + unc-119(+)]. pwIs116 [rme-2p::rme-2::GFP::rme-2 3'UTR + unc-119(+)]. Maintain at 20-25C to reduce silencing of the array.

ltSi539 [dlg-1p(delta)7::mCherry::his-72::unc-54 3’UTR + cnd-1p::mCherry::his-72::unc-54 3’UTR + Cbr-unc-119(+)] II. ltSi507 [hlh-1p::GFP::his-72::tbb-2 3’UTR + hlh-1p::mCherry::his-72::tbb-2 3’UTR +Cbr-unc-119(+)] IV. stIs10389 [pha-4::TGF(3E3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. During embryogenesis, ectoderm fluoresces red, mesoderm fluoresces yellow, and endoderm/pharynx fluoresces green. Reference: Wang S, et al. Development. 2019 Apr 11;146(7):dev174029. doi: 10.1242/dev.174029. PMID: 30890570.

ltSi569 [CEOP3608 tbg-1::mCherry + Cbr-unc-119(+)] inserted into oxTi185 [ttTi5605 + NeoR(+) + unc-18(+)] I. ltSi592 [spd-2p::gfp::spd-5(S653A S658A, re-encoded) + Cbr-unc-119(+)] II. Small centrosomes. mCherry-labeled gamma tubulin. GFP-labeled centrioles. Derived by crossing parental strains OD1801 with OD1709. Reference: Woodruff JB, et al. Science. 2015 May 15;348(6236):808-12. doi: 10.1126/science.aaa3923. PMID: 25977552

ltSi249 [dlg-1p(delta)7::dlg-1::GFP::unc-54 3'UTR Cbr-unc-119(+)] I. ltSi511 [cnd-1p::mCherry::PH::unc-54 3'UTR Cbr-unc-119(+)] II. During embryogenesis epidermal cell junctions fluoresce green and neuronal cell surface fluoresces red. Reference: Wang S, et al. Development. 2019 Apr 11;146(7):dev174029. doi: 10.1242/dev.174029. PMID: 30890570.

ltSi569 [CEOP3608 tbg-1::mCherry + Cbr-unc-119(+)] inserted into oxTi185 [ttTi5605 + NeoR(+) + unc-18(+)] I. ltSi1141 [spd-2p::gfp::spd-5(re-encoded) + Cbr-unc-119(+)] II. Re-encoded spd-5 is siRNA-resistant. mCherry-labeled gamma tubulin. GFP-labeled centrioles. Reference: Woodruff JB, et al. Science. 2015 May 15;348(6236):808-12. doi: 10.1126/science.aaa3923. PMID: 25977552