Search Strains

3xFLAG and eGFP tags inserted into the endogenous hlh-30 locus. Superficially wild-type. Diffuse GFP in basal growing conditions and strong nuclear labeling upon diverse stresses like starvation, Staphylococcus aureus infection, arsenite, diethylmaleate, heat shock or levamisole. GFP expression is only visible at high magnification; not discernible with a fluorescence stereoscope. Insertion can be detected by PCR. Forward primer sequence: 5' acgcacgcaactgcttta; Reverse primer (in 3'UTR): 5' aataacctgcgattctgg; Reverse primer (in eGFP): CTTGAAGAAGATGGTACGCTC. Expected products (For&Rev 3'UTR): 910 bp (WT)/1878 bp (syb1452). Expected products (For&Rev eGFP): no band (WT)/811 bp (syb1452). Insertion allele generated by SunyBiotech and out-crossed twice with VZ Lab N2. Reference: Martina JA, et al. EMBO J. 2021 Feb 1;40(3):e105793

wbmIs97 [eft-3p::tomm-20(aa1-49)::GFP::unc-54 3'UTR] *wbmIs65. Somatic-specific TOMM-20(1-49)::GFP expression driven by the eft-3p promoter allows imaging of mitochondria without some of the adverse side effects of extrachromosomal arrays. Derived by CRISPR-mediated insertion of TOMM-20::GFP downstream of tissue-specific eft-3 promoter of wbmIs65 insertion in parental strain WBM1140. wbmIs65 [eft-3p::3XFLAG::dpy-10 crRNA::unc-54 3'UTR] (V:8645000). Reference: Valera-Alberni M, et al. Life Science Alliance Sep 2024, 7 (11) e202402918; DOI: 10.26508/lsa.202402918. PMID: 39071403.

wbmIs98 [eft-3p::tomm-20(aa1-49)::mCherry::unc-54 3'UTR] *wbmIs65. Somatic-specific TOMM-20(1-49)::mCherry expression driven by the eft-3p promoter allows imaging of mitochondria without some of the adverse side effects of extrachromosomal arrays. Derived by CRISPR-mediated insertion of TOMM-20::mCherry downstream of tissue-specific eft-3 promoter of wbmIs65 insertion in parental strain WBM1140. wbmIs65 [eft-3p::3XFLAG::dpy-10 crRNA::unc-54 3'UTR] (V:8645000). Reference: Valera-Alberni M, et al. Life Science Alliance Sep 2024, 7 (11) e202402918; DOI: 10.26508/lsa.202402918. PMID: 39071403.

uthIs248 [aak-2p::aak-2(genomic aa1-321)::GFP::unc-54 3'UTR + myo-2p::tdTOMATO]. Ubiquitous GFP expression and pharynx-specific tdTomato expression. Small with slight developmental delay and reduced reproductive capacity. Some phenotypes silence quickly. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.

neSi101 [sun-1p::TIR1::mRuby::eft-3 3'UTR + Cbr-unc-119(+)] IV. GFP reporter inserted into C-terminus of endogenous oma-1 locus. AID* degron tag (IAA17) inserted into the endogenous oma-2 locus. Reference: Ertekin A, et al. bioRxiv. 2025 May 12:2025.05.09.653132. doi: 10.1101/2025.05.09.653132. PMiD: 40463014.

neSi101 [sun-1p::TIR1::mRuby::eft-3 3'UTR + Cbr-unc-119(+)] IV. GFP reporter inserted into C-terminus of endogenous oma-1 locus. A triple arginine motif upstream of the oma-1 tandem zinc finger domain is mutated to three alanines. AID* degron tag (IAA17) inserted into the endogenous oma-2 locus. When OMA-2 is present, this mutant does not appear to have obvious phenotypes. Auxin-inducible depletion of OMA-2 causes embryonic lethality: animals lay low numbers of nonviable embryos that are often polynucleated and have weak chitin shells. Reference: Ertekin A, et al. bioRxiv. 2025 May 12:2025.05.09.653132. doi: 10.1101/2025.05.09.653132. PMiD: 40463014.

ZC317.3 Homozygous. Outer Left Sequence: TCAAAATACAGGGGTAGGCG. Outer Right Sequence: ACAATTCCTGGAACTCACGG. Inner Left Sequence: TGAAGAGGTTTTGAAACGCA. Inner Right Sequence: ACTTTCCGAGAGGAATGGGT. Inner Length: 2746. Estimated Deletion Size: 1200. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu/

R09B5.11 Homozygous. Outer Left Sequence: ctgtcgcaagtcctgattga. Outer Right Sequence: gtttccggaacaaacttcca. Inner Left Sequence: gaacgagtgtttctgggacg. Inner Right Sequence: atgaggaaggcgtactggtg. Inner Primer PCR Length: 3113. Deletion size: 1273 bp. Left flank: TATCAGTTTGAAGAGGCACTCGAAAACCTT. Right flank: ACTGTTCTATATATAAGCTGAAGTTCAACC. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu/

qaIs8400 [let-858p::Ov-GST-3 + rol-6(su1006)]. Called AK1 in the reference article. The Ov-GST-3 gene was amplified from genomic DNA of O. volvulus with 1µM of the sequence specific primer 5'Klon and 3'Klon (5'Klon: 5'-GGCGTACGATGTCAAGATTTCCTCAACAAG-3'; 3'Klon: 5'-GGTCTAGATTTATTTAGGAATGATTGAATCGGTCG-3'; representing bases 4 - 25 and the complementary sequence of bases 821 - 841 of the published Ov-GST-3 cDNA (AF203814); bold underlines indicate restriction sites for Pfl23II (SplI) and XbaI, respectively; dotted underline indicates the start codon for translation; italics indicates the conserved sequence for the polyadenylation signal for transgenic transcript processing; the 8 5'-nucleotides of primer 3'Klon and the fourteen 5'-nucleotides of primer 5'Klon do not correspond to the template and introduce the sequences to the amplicon), 200 µM of each deoxynucleotide (Gibco BRL) and 2.5 units of Taq polymerase (Gibco BRL). After an initial denaturation of 3 minutes at 93°C, 35 cycles of annealing at 55°C for 1 minute, synthesis at 72°C for 2 minutes and a 1 minute denaturation at 93°C were performed, followed by a final extension at 72°C for 5 minutes. The genomic Ov-GST-3 fragment obtained by PCR (see above) was ligated into the pGEM-T Easy vector (Promega) by TA-cloning, cleaved with the restriction enzymes Pfl23II (SplI) and XbaI (restriction sites introduced by the primer) and inserted between the unique Pfl23II (SplI) and XbaI sites of the vector pPD103.05 (kindly provided by A. Fire). The sequence of the genomic Ov-GST-3 fragment in the resulting plasmid pAK1 was confirmed by automated dye terminator, dideoxy sequencing (ABI Prism 377TM Sequencer, PE Applied Biosystems) using the PCR primers (see above). The pAK1 DNA was injected in combination with the marker plasmid pRF4 [rol-6(su1006)] into the gonads of N2 C. elegans at a concentration of approximately 100 ng/µl for each plasmid. Transgenic worms were identified by the selectable Roller marker phenotype and the stable transmitting line AK1ex (AK1 extrachromosomal) was established. Integration of the extrachromosomal arrays was achieved by irradiation of AK1ex worms with 3600 rad (1 rad = 0.01 Gy) of x-rays (x-ray chamber: RUM 9421-070-77002, Philips, Netherlands; dosimeter: PTW-SN4, PTW, Germany). The progeny of these worms was then screened for 100% transmittance of the Roller phenotype to obtain the C. elegans line AK1int (AK1 integrated) with the chromosomally integrated transgenes.

Becomes very sick if starved for extended periods of time or if frozen and thawed repeatedly. Primer sequences provided by the C. elegans Reverse Genetics Core Facility for ok410 are: Outer Left Sequence: AAGACTGTCAGCTGGTGGGT. Outer Right Sequence: TTAGCCTTACATTGCCGCTT. Inner Left Sequence: TCATGCGCAACATCTAAAGC. Inner Right Sequence: CGAATAAAGCAATTTCCCGA. Inner primer WT PCR product: 2825.

Egl. Backward stiff and slow moving. Sluggish. Can move fast when poked. Outer pairs: F59F5.6EL1 (TTGCATCTGCAAAAGAAACG); F59F5.6ER1 (GCTCCGAACGAAAGAAGTTG). Inner pairs: F59F5.6IL1 (AATCTCTAACCATGCGGTCG); F59F5.6IR1 (CGCGGGAATTATGCCTATTA).

fjSi3 [HA_2×FLAG::C04F12.1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The HA_2×FLAG::C04F12.1 transgene was designed to express a protein with an HA tag and a double FLAG tag inserted after S21 of C04F12.1. The linker sequence between the HA tag and the double FLAG tag has a NotI site. The insertion can be checked by PCR with the following primers: GGAGCCGATTTGTTCCAGTC (at the 3'-side of C04F12.1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Maintain at 20C or lower. The cec-4 cec-5 double mutant exhibits partial sterility and no significant defects in chromosome segregation. The chromodomain proteins CEC-4 and CEC-5 are phylogenetically similar to CEC-8. ok3124 is a 374-bp deletion located in the region of the gene corresponding to the N-terminus of CEC-4 (F32E10.2). The ok3124 deletion can be detected by PCR with the following primers: CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC. fj58 is a 398-bp deletion located in the gene region corresponding to the N-terminus of CEC-5 (F32E10.6). The fj58 deletion can be detected by PCR with the following primers: GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. The fj54 mutation deletes a 524 bp region including half of the second exon, the third exon, and almost all of the fourth exon, causing a frame shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA.

Maintain at 20C or lower. Him. cec-4 cec-5 him-8 triple mutants exhibit partial sterility. The intensity of histone H3K9me2 on meiotic chromosomes is reduced. ok3124 deletion can be detceted by PCR with the following primers: CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC. fj61 is a 444-bp deletion located in the region of the gene corresponding to the N-terminus of CEC-5 (F32E10.6). The fj61 deletion can be detected by PCR with the following primers: GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj67) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Intracellular localization of CSR-1 is abnormal in the csr-1(fj67) homozygotes. fj67 is a 60-bp in-frame deletion of the first lysine-rich region (KQKDNFILLDILLKQWAAKK) in CSR-1. The first lysine-rich region in the WT has a FokI site. The deletion can be checked by PCR with the following primers: CACCTGTGATTTTTCGGGGAAC and TGGATTCCTTTTGCTGCAACAG, followed by digestion with FokI. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj70) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. fj70 is a D769L mutation that renders CSR-1 (an Argonaute protein) catalytically defective and generates a new SphI site. The fj70 mutation can be checked by PCR with the following primers: TACACGTGGATGATGAGAAG and TCGTCCGAAACTTCCTCATC, followed by digestion with SphI. Homozygous nT1[qIs51] inviable. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Four amino-acid residues (G24–V27) near the N-terminus of EGO-1 were replaced with a PA-tag sequence (GVAMPGAEDDVV derived from human podoplanin) in the endogenous ego-1 gene. The PA-tag insertion can be checked by PCR with the following primers: TTCAAAATGCCGCTGCCTTC and GTCCTCTTCGCATCTTTATCAG, followed by digestion with Sau96I. The wild-type ego-1 gene contains a Sau96I site within its PCR region, while the PA-tagged ego-1 does not. This strain was used for immunofluorescence analysis of EGO-1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

fjSi19 [rpl-21p::2×HA::C04F12.1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The 2×HA::C04F12.1 transgene was designed to express a protein with a double HA tag at its N-terminus, using a strong ubiquitous promoter (rpl-21p). The linker sequence between the two HA tags has a NotI site. The insertion can be checked by PCR with the following primers: GGAGCCGATTTGTTCCAGTC (at the 3'-side of C04F12.1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj126) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. fj126 was generated by the insertion of a synthetic nuclear export signal (NES). Instead of six amino-acid residues (R8–I13) near the N-terminus of CSR-1b, an NES sequence (LNELALKLAGLDI) from the cAMP-dependent protein kinase inhibitor alpha in mammals was inserted into the endogenous csr-1 gene. The DNA sequence encoding the NES has a HindIII site. The fj126 mutation can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and CCGCTGAGGAACGAGATGG, followed by digestion with HindIII. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

CeRep55 quadruple deletion: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, AGTAGTTACAAAGCGATATACGAAC and TTCGCCGACTCATAGACATCTG; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Sterile csr-1 allele balanced over tmC5 labelled with Venus. Heterozygotes are wild-type with somewhat dimmer Venus signal and segregate WT Venus(+) heterozygotes, Mec Unc Venus(+) tmC5 homozygotes, and non-Venus csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. Homologous pairing and unpaired silencing of meiotic chromosomes are inaccurate in this csr-1 null-mutant homozygotes. The fj54 deletion causes a frame-shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA. The inversion-based balancer in ZT60 is more amenable to producing csr-1(fj54) homozygous males than a translocation-based balancer (ZT3). Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Sterile csr-1 allele balanced over tmC5 labelled with Venus. Heterozygotes are wild-type with somewhat dimmer Venus signal and segregate WT Venus(+) heterozygotes, Mec Unc Venus(+) tmC5 homozygotes, and non-Venus csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. Homologous pairing and unpaired silencing of meiotic chromosomes are inaccurate in homozygous tm1637; fj54 double mutants. The vsra-1 mutation enhances the defects caused by the csr-1 mutation. The fj54 deletion causes a frame-shift to stop the translation of both PAZ and Piwi domains. tm1637 can be detected by PCR with the following primers: AAGCAGTTCTTCAAGACTGGTC and TTGTCCACTCGCACTTTGTG. The fj54 deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA. vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Maintain at 20C or lower. The met-2 set-25 double mutant exhibits partial sterility and no significant defects in chromosome segregation. MET-2 and SET-25 are the methyltransferases responsible for histone H3K9me2 and H3K9me3. The deletion mutations can be checked by PCR with the following primers: met-2(ok2307), GGTTGATGCGGAGAAGACTG and AATGGATTCGGTGCTTCGTG; set-25(n5021), GAGCCCGTGCCACAGAGTAG and CCTAGAGCGATGTCCTTGATGG. This strain was used as a negative control in the immunodetection of H3K9me2.

RNAi deficient (Rde). Him. Partially-inaccurate paring of meiotic chromosomes. fj150 is a mutation changing WK to FS and generating a new FspI site in the second K-rich region between the PAZ and Piwi domains. The fj150 mutation can be detected by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC, followed by digestion with FspI. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

fj150 is a mutation changing WK to FS and generating a new FspI site in the second K-rich region between the PAZ and Piwi domains. fj150 is enhanced by the CeRep55 quadruple deletion. The fj150 mutation can be detected by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC, followed by digestion with FspI. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, AGTAGTTACAAAGCGATATACGAAC and TTCGCCGACTCATAGACATCTG; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

The CeRep55_X quadruple-deletion mutant does not exhibit a clear Him phenotype, but the Him phenotype of the him-1(e879) mutant is enhanced by the CeRep55_X quadruple deletions. CeRep55 quadruple deletion: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, AGTAGTTACAAAGCGATATACGAAC and TTCGCCGACTCATAGACATCTG; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. The e879 mutation can be checked by PCR with the following primers: AAATCAGGAGTGGGCATCAG and GGGAAGATTCCGATGAGTGA, followed by digestion with MvaI. The wild-type him-1 gene contains an MvaI site within its PCR region, while the e879 allele does not. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

RNAi deficient (Rde). High incidence of males (Him). fj162 at the second K-rich region is an in-frame duplication (comprising of a small duplication and a tiny inverted duplication) generating 61 extra amino acids. The fj162 mutation can be checked by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC.

fj162 at the second K-rich region is an in-frame duplication (comprising of a small duplication and a tiny inverted duplication) generating 61 extra amino acids. The CeRep55_X quadruple-deletion mutant does not exhibit a clear Him phenotype, but the Him phenotype of the csr-1(fj162) mutant is enhanced by the CeRep55_X quadruple deletions. The fj162 mutation can be checked by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, AGTAGTTACAAAGCGATATACGAAC and TTCGCCGACTCATAGACATCTG; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

This strain carries a dpy-5 mutation to facilitate genome modification in CeRep55 quadruple deletion background: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, AGTAGTTACAAAGCGATATACGAAC and TTCGCCGACTCATAGACATCTG; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Pick wild-type Venus+ animals to maintain. coh-4(tm1857) coh-3(gk112) homozygotes exhibit defects in synaptonemal complex formation on meiotic chromosomes. Many of the progeny from coh-4 coh-3 homozygotes exhibit embryonic lethality, likely due to aneuploidy, but only a few progeny hatch and exhibit the Him phenotype. The coh-3 and coh-4 genes encode nearly identical meiosis-specific kleisins. The deletion mutations can be checked by PCR with the following primers: coh-4(tm1857): TACGCGGCACACATGGGTCT and CAATTCCCCCTAGACATACGATTC; coh-3(gk112): CTCGCAGCGATCGAGCAAGC and AACTGAACATGAGAGCCACGAAG. tmC16 homozygotes are Unc Venus(+). [NOTE: ZT73 with the inversion-based balancer is more amenable to producing coh-4 coh-3 homozygous mutant males than TY5120 with a translocation-based balancer.] Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.