Strain Information
| Name | ZT56 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | fjSi19 II; unc-119(ed3) III. |
| Description | fjSi19 [rpl-21p::2×HA::C04F12.1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The 2×HA::C04F12.1 transgene was designed to express a protein with a double HA tag at its N-terminus, using a strong ubiquitous promoter (rpl-21p). The linker sequence between the two HA tags has a NotI site. The insertion can be checked by PCR with the following primers: GGAGCCGATTTGTTCCAGTC (at the 3'-side of C04F12.1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002. |
| Mutagen | MosSCI |
| Outcrossed | x0 |
| Made by | Hiroaki Tabara |
| Laboratory | YK |
| Reference | Tabara H, Mitani S, Mochizuki M, Kohara Y, Nagata K (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002. |
Sign in
or
register an account if you want to order this strain.