Search Strains

More Fields
Strain Species Genotype Add
EU573 C. elegans orEx2. Show Description
orEx2 [mlc-4p::mlc-4(genomic coding)::GFP::unc-54 3'UTR + rol-6(su1006)]. Maintain by picking Rollers. Rollers are GFP+.
EV484 C. elegans efIs155 II. Show Description
efIs155 [mex-5p::rpl-4::FLAG::tbb-2 3?UTR + Cbr-unc-119(+)] II. Tagged RPL-4 can be used for ribosome purifications from germ cells. Reference: Nousch M, et al. G3 (Bethesda). 2020 Sep 3:g3.401644.2020. doi: 10.1534/g3.120.401644
FGP29 C. elegans gei-17(fgp1[GFP::FLAG::AID*::loxP::gei-17]) I; ieSi38 IV. Show Description
gei-17(fgp1[GFP::FLAG::AID*::loxP::gei-17]) I. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. Reference: Pelisch et al. Mol Cell. 2017 Jan 5;65(1):66-77.
FT204 C. elegans unc-119(ed3) III; xnIs87. Show Description
xnIs87 [syn-4p::GFP::syn-4::syn-4 3'UTR + unc-119(+)].
FT2465 C. elegans xnSi85 I; hmg-5(xn168[hmg-5::gfp(11)] IV. Show Description
xnSi85 [mex-5p::mito(matrix)::GFP(1-10)::nos-2 3’UTR] I. Split GFP HMG-5/TFAM labels mtDNA nucleoids in primordial germ cells and germ line. Reference: Schwartz AZA, et al. eLife. 2022 Oct 6:11:e80396. doi: 10.7554/eLife.80396. PMID: 36200990.
FT250 C. elegans unc-119(ed3) III; xnIs96. Show Description
xnIs96 [pJN455(hmr-1p::hmr-1::GFP::unc-54 3'UTR) + unc-119(+)]. GFP starts in membranes at~100 cell stage, becomes bright apically in older embryos and larvae; most prominent in nerve ring in adults. Reference: Achilleos et al. (2010) Development 137(11):1833-42.
FT741 C. elegans xnSi6 II; unc-119(ed3) III. Show Description
xnSi6 [mex-5p::hmr-1::GFP::hmr-1 3'UTR + unc-119(+)] II. HMR-1::GFP localized at cell contacts in early embryos and becomes enriched in PGCs. Reference: Chihara D & Nance J. Development. 2012 Jul;139(14):2547-56. Klompstra D, et al. Nat Cell Biol. 2015 Jun;17(6):726-35.
GC771 C. elegans him-5(e1490) V; naEx57. Show Description
naEx57 [lag-2p::FLP::let-858 3'UTR + ceh-22p::GFP]. Him. Derived by injection of plasmids pGC158 and pCW2.19. Reference: Voutov, R and Hubbard, EJ. Genetics 180(1):103-19 (2008).
GC773 C. elegans unc-119(ed3) III; naIs3. Show Description
naIs3 [(pGC133) hsp-16.41::FLP:::let-858 3'UTR) + Cbr-unc-119(+)].
GC817 C. elegans unc-119(ed3) III; naIs6. Show Description
naIs6 [hsp-16.2p::FLP::let-858 3'UTR + Cbr-unc-119(+) + ceh-22p::GFP)].
GC822 C. elegans unc-119(ed3) III; naEx75. Show Description
naEx75 [(pGC146) hsp-16.2p::FLP::let-858 3'UTR) + Cbr-unc-119(+) + (pCW2.1) ceh-22p::GFP)]. Array was bombarded but did not integrate.
GC827 C. elegans unc-119(ed3) III; naIs7. Show Description
naIs7 [hsp-16.2p::FLP::let-858 3'UTR + Cbr-unc-119(+)]. Does not express ceh-22p::GFP, but unc-119 is rescued.
GLW27 C. elegans muIs252 II; unc-119(ed3) his-72(utx21[his-72::wrmScarlet11::3xMyc]) III. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of HIS-72 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous his-72 locus. Genetic background: strain CF4582. Insertion verified by PCR and fluorescence. Left flank: 5' CTCGCCAGACGCATTCGCGGAGAACGTGCT 3' (one silent mutation); Right flank: 5' TAAgctccatcaccaattctcgaagcactt 3'; sgRNA: GAGCTTAAGCACGTTCTCCG; Cas9/sgRNA plasmid: pGLOW87; wrmScarlet11^SEC^3xMyc plasmid: pGLOW88; SEC insertion allele strain: GLW26
GLW29 C. elegans muIs252 II; unc-119(ed3) III; egl-1(utx23[egl-1::wrmScarlet11::3xMyc]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of EGL-1 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous egl-1 locus. Genetic background: strain CF4582. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' CAGAAGTCTCTTCCATCGTCTTCTGGACTTTTTCGCTTTT 3' (one silent mutation); Right flank: 5' TAAgtgatcaaaatctccaacttttctcca 3'; sgRNA: AGTCCAGAAGACGATGGAAG; Cas9/sgRNA plasmid: pGLOW65; wrmScarlet11^SEC^3xMyc plasmid: pGLOW66; SEC insertion allele strain: GLW28.
GMC101 C. elegans dvIs100. Show Description
dvIs100 [unc-54p::A-beta-1-42::unc-54 3'-UTR + mtl-2p::GFP]. mtl-2p::GFP produces constitutive expression of GFP in intestinal cells. unc-54p::A-beta-1-42 expresses full-length human A-beta-1-42 peptide in bodywall muscle cells that aggregates in vivo. Shifting L4 or young adult animals from 20C to 25C causes paralysis. Reference: McColl G, et al. Mol Neurodegener. 2012 Nov 21;7:57.
GR1322 C. elegans pdk-1(sa680) X; mgEx470. Show Description
mgEx470 [pdk-1(+) + ttx-3::GFP]. Pick GFP+ to maintain. 9.2-kb PCR product of genomic DNA from the pdk-1(+) genomic region containing 2.7 kb of 5' upstream regulatory sequence, 6.1 kb of coding sequencing containing introns and exons, and 0.4 kb of pdk-1 3' UTR. Reference: Paradis S, et al. Genes Dev. 1999 Jun 1;13(11):1438-52.
GR1337 C. elegans daf-2(e1370) III; njEx38. Show Description
njEx38 [unc-54p::daf-2(cDNA)::unc-54 3'UTR + unc-54p::GFP + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.
GR1340 C. elegans daf-2(e1370) III; mgEx373. Show Description
mgEx373 [unc-119p::daf-2(cDNA)::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.
GR1672 C. elegans mgEx340. Show Description
mgEx340 [akt-1::GFP::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. AKT-1::GFP translational fusion containing 6.7 kb akt-1 genomic DNA including 3.2 kb of 5' upstream regulatory region and 3.5 kb of coding region (including exons and introns) fused in-frame to GFP with unc-54 3' UTR. Reference: Paradis S, Ruvkun G. Genes Dev. 1998 Aug 15;12(16):2488-98.
GR1673 C. elegans mgEx341. Show Description
mgEx341 [akt-2::GFP::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. AKT-2::GFP translational fusion containing 5.2 kb akt-1 genomic DNA including 2.1 kb of 5' upstream regulatory region and 3.1 kb of coding region (including exons and introns) fused in-frame to GFP with unc-54 3' UTR. Reference: Paradis S, Ruvkun G. Genes Dev. 1998 Aug 15;12(16):2488-98.
GR1674 C. elegans mgEx481. Show Description
mgEx481 [pdk-1::GFP::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. PDK-1::GFP translational fusion containing 9 kb akt-1 genomic DNA including 2.9 kb of 5' upstream regulatory region and 6.1 kb of coding region (including exons and introns) fused in-frame to GFP with unc-54 3' UTR. Reference: Paradis S, et al. Genes Dev. 1999 Jun 1;13(11):1438-52.
GR1719 C. elegans unc-119(ed3) III; mgSi3 IV. Show Description
mgSi3 [(pCMP2)ubl-1p::GFP::ubl-1-3'UTR + Cbr-unc-119(+)] IV. Strong ubiquitous GFP expression. Can be used as a control for a strain containing an endogenous siRNA sensor (GR1720). Reference: Montgomery TA, et al. PLoS Genet. 2012;8(4):e1002616.
GR1720 C. elegans unc-119(ed3) III; mgSi4 IV. Show Description
mgSi4 [(pCMP2)ubl-1p::GFP::siR-1-sensor-ubl-1-3'UTR + Cbr-unc-119(+)] IV. Very weak ubiquitous GFP expression. The 22G siR-1 sensor transgene is more sensitive to gene inactivations that affect 22G siR-1 levels when grown at 25C compared to 20C. Reference: Montgomery TA, et al. PLoS Genet. 2012;8(4):e1002616.
GR1748 C. elegans unc-119(ed3) III; mgSi2 IV. Show Description
mgSi2 [mut-16p::mut-16::GFP::mut-16 3'UTR + unc-119(+)] IV. MosSCI integrant of mut-16::GFP rescues pk710. Reference: Phillips CM, et al. Genes Dev. 2012 Jul 1;26(13):1433-44.
GR2107 C. elegans daf-2(e1370) III; mgEx371. Show Description
mgEx371 [dpy-30p::daf-2(cDNA)::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.
GR2198 C. elegans mgTi1 I; unc-119(ed3) III. Show Description
mgTi1 [rpl-28p::skn-1a::GFP::tbb-2 3'UTR + unc-119(+)] I. Expresses SKN-1A with C-terminal GFP tag. Reference: Lehrbach NL & Ruvkun G. Elife. 2016 Aug 16;5. pii: e17721
GR2250 C. elegans mgIs73 V. Show Description
mgIs73 [cyp-14A4p::gfp::cyp-14A4 3’UTR + myo-2p::mCherry] V. Reference: Mao K, et al. Cell Metab. 2019 Feb 14. pii: S1550-4131(19)30022-1.
GR2252 C. elegans hsp-6(mg585) V; mgIs73 V. Show Description
mgIs73 [cyp-14A4p::GFP::cyp-14A4 3’UTR + myo-2p::mCherry] V. Slow growth. Low brood size. Received as a replacement for GR2249. Reference: Mao K, et al. Cell Metab. 2019 Feb 14. pii: S1550-4131(19)30022-1.
GS10037 C. elegans arSi159 [rps-27p::GFP(flexon)::H2B::unc-54 3'UTR + Cbr-unc-119(+)] II; unc-119(ed3) III. Show Description
arSi159 [rps-27p::GFP(LoxP-flexon-LoxP)::H2B::unc-54 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 (II). The first intron of GFP was replaced with a Flexon containing two loxP sites. High level GFP::H2B expression requires Cre expression from a second transgene. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.
GS8190 C. elegans arTi85. Show Description
arTi85 [lin-31p::ERK::KTR::mClover::T2A::mCherry::his-11::unc-54 3'UTR + rps-27p::NeoR::unc-54 3'UTR]. Superficially wild-type. arTi85 transgene is a single-copy transposon insertion expressing a fluorescent protein (ERK::KTR::mClover) that reports MPK-1 kinase activity in vulval precursor cells (VPCs). A nuclear histone marker is co-expressed (mCherry::H2B). Reference: de la Cova C, et al. Developmental Cell. 2017 Vol. 42(5):542-553.
GS8255 C. elegans arTi101. Show Description
arTi101 [lin-31p::ERK::KTR(S43A, T55A, S62A)::mClover::T2A::mCherry::his-11::unc-54 3'UTR + rps-27p::NeoR::unc-54 3'UTR]. Superficially wild-type. arTi101 transgene is a single-copy transposon insertion expressing a mutant, unphosphorylated form of a fluorescent protein (ERK::KTR::mClover) that reports MPK-1 kinase activity in vulval precursor cells (VPCs). A nuclear histone marker is co-expressed (mCherry::H2B). Use arTi101 as a negative control for transgene arTi85. Reference: de la Cova C, et al. Developmental Cell. 2017 Vol. 42(5):542-553.
GS8513 C. elegans arTi145 II. Show Description
arTi145 [ckb-3p::mCherry::his-58::unc-54 3'UTR] II. miniMos insertion with bright expression due to perdurance mediated by the histone; expressed in all cells from Z1/Z4 until somatic gonad blast cells divide, so labels the entire somatic gonad primordium in continuous L2 or dauer larvae. Reference: Attner et al., 2019, Current Biology 29, 1-7.
GS8729 C. elegans arSi12. Show Description
arSi12 [mex-5p::ERK::KTR::GFP(smu-1 introns)::T2A::mCherry::his-11::tbb-2 3'UTR]. arSi12 is a single-copy CRISPR/Cas9-engineered insertion expressing a fluorescent protein (ERK::KTR::GFP) that reports MPK-1 kinase activity in the germline. A nuclear histone marker is co-expressed (mCherry::H2B). Reference: de la Cova C, et al. Developmental Cell. 2017 Vol. 42(5):542-553.
GS8752 C. elegans arSi15. Show Description
arSi15 [mex-5p::ERK::KTR(S43A, T55A, S62A)::GFP(smu-1 introns)::T2A::mCherry::his-11::tbb-2 3'UTR]. arSi15 is a single-copy CRISPR/Cas9-engineered insertion expressing a mutant, unphosphorylated form of a fluorescent protein (ERK::KTR::GFP) that reports MPK-1 kinase activity in the germline. A nuclear histone marker is co-expressed (mCherry::H2B). Use arSi15 as a negative control for transgene arSi12. Reference: de la Cova C, et al. Developmental Cell. 2017 Vol. 42(5):542-553.
GS9402 C. elegans arTi362 Show Description
arTi362 [rps-27p::TIR1(lox2272-flexon-lox2272)::unc-54 3'UTR + HygroR] V (-19.98). The first intron of TIR1 was replaced with a Flexon containing two lox2272 sites. TIR1 is expressed at a high level in lineages where Cre is expressed. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.
GS9407 C. elegans arTi361 [rps-27p::GFP(lox2272-flexon-lox2272)::H2B::unc-54 3'UTR + NeoR] I. Show Description
arTi361 [rps-27p::GFP(lox2272-flexon-lox2272)::H2B::unc-54 3'UTR + NeoR] I (-12.74). First intron of GFP is replaced with a Flexon containing two lox2272 sites. GFP::H2B is expressed at a high level in lineages where Cre is expressed with a second transgene. Transgene maps to -12.74 (I). Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology.
GS9820 C. elegans arTi443 Show Description
arTi443 [rps-27p::TIR1(F79G)(lox2272-flexon-lox2272)::unc-54 3'UTR + HygroR] V (+21.99). The first intron of TIR1(F79G) was replaced with a Flexon containing two lox2272 sites. TIR1(F79G) is expressed at a high level in lineages where Cre is expressed with a second transgene. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.
GS9847 C. elegans arTi452 [rps-27p::GFP(LoxP-flexon-LoxP)::H2B::unc-54 3'UTR + NeoR] I. Show Description
arTi452 [rps-27p::GFP(LoxP-flexon-LoxP)::H2B::unc-54 3'UTR + NeoR] I (-4.81). First intron of GFP is replaced with a Flexon containing two loxP sites. GFP::H2B is expressed at a high level in lineages where Cre is expressed with a second transgene. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.
GS9922 C. elegans arTi461 [rps-27p::GFP(FRT-flexon-FRT)::H2B::unc-54 3'UTR + NeoR] I. Show Description
arTi461 [rps-27p::GFP(FRT-flexon-FRT)::H2B::unc-54 3'UTR + NeoR] I (-3.80). The first intron of GFP was replaced with a Flexon containing two FRT sites. GFP::H2B is expressed at a high level in lineages where Flp recombiase is expressed with a second transgene. Flexon contains two FRT sites. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.
GT332 C. elegans aSi10 II; unc-119(ed3) III. Show Description
aSi10 [lox2272 Cbr-unc-119(+) lox2272 + loxP::unc-54 3’UTR::Split 3’ HygR::tjp2a_guide::Split 3’ mScarlet-I::egl-13nls::tbb-2 3’UTR]?II. Strain contains a specialized safe harbor transgene landing pad for integration of promoters to drive mScarlet. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.
GW1028 C. elegans met-2(n4256) set-25(n5021) III; rrrSi192 [mex-5p::GFP::H2B::tbb-2 3'UTR + unc-119(+)] II. Show Description
Worms are slow growing, with reduced brood size and become sterile at elevated temperatures. met-2 and set-25 mutants co-segregate with ~ 20cM distance. Express GFP::H2B in germline and early embryos. Might still carry unc-119(ed3) in background. Reference: Zeller P, et al. Nat Genet. 2016 Nov;48(11):1385-1395. doi: 10.1038/ng.3672. PMID: 27668659.
GW1119 C. elegans lsm-8 (xe17[myo-2p::mCherry::unc-54 3'UTR]) IV/nT1 [qIs51] (IV;V); pkIs1582 V/nT1 [qIs51] (IV;V). Show Description
pkIs1582 [let-858::GFP + rol-6(su1006)] V. Homozygous lethal lsm-8 deletion balanced by GFP-marked nT1 translocation. xe17 generated by CRISPR/Cas9-engineered replacement of the gene with a red pharyngeal marker. lsm-8 heterozygotes are wild-type (will roll in this case because of pkIs1582) green & red pharynx, and will segregate rolling heterozygotes (green & red pharynx), arrested nT1[qIs51] aneuploids (only green pharynx), and lsm-8 homozygotes (only red pharynx). Homozygous nT1[qIs51] inviable. Pick rollers with green & red pharynx and check for correct segregation of progeny to maintain. Reference: Mattout A, et al. Nat Cell Biol. 2020 May;22(5):579-590. PMID: 32251399
GW1262 C. elegans xeSi302 II; gwIs114. Show Description
xeSi302 [nhx-2p::npp-9::GFP::BLRP::3xFLAG::unc-54 3'UTR + Cbr-unc-119(+)] II. gwIs114 [hsp-16.2p::hlh-1 + rol6(su1006)]. Intestine-specific expression of nuclear GFP reporter. Rollers have heat-shock-inducible expression of hlh-1 transcription factor. gwIs114 was generated using constructs provided by Michael W. Krause`s lab (NIDDK). Reference: Gonzalez-Sandoval A, et al. Cell. 2015 Dec 3;163(6):1333-47. doi: 10.1016/j.cell.2015.10.066. PMID: 26607792.
GW1394 C. elegans gwIs39 III; bqSi225 IV; gwIs59. Show Description
gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. bqSi225 [emr-1p::emr-1::mCherry + unc-119(+)] IV. gwIs59 [pha-4::mCherry::256xLacO::4xLexA + unc-119(+)]. Superficially wild-type. Express ubiquitous EMR-1::mCherry at the nuclear periphery. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have red intestine (all stages) and green intestine (from late L4 stage). Reference: Harr JC, et al. Genes Dev. 2020 Apr 1;34(7-8):560-579. PMID: 32139421.
GW1539 C. elegans gwSi34 II; met-2(gw1419[met-2::FLAG::TEV::mCherry]) III. Show Description
gwSi34 [lem-2p::lem-2::GFP-3xFlag::lem-2 3'UTR] II. Superficially wild-type. Endogenously tagged met-2 locus. LEM-2::GFP is detectable at the nuclear periphery, and MET-2::mCherry signal detectable throughout nucleoplasm of all germline and somatic tissues. Reference: Delaney CE, et al. J Cell Biol. 2019 Mar 4;218(3):820-838. PMID: 30737265
GW215 C. elegans hpl-2(tm1489) III; gwIs4 X. Show Description
gwIs4 [myo-3p::RFP + baf-1::GFP-lacI:::let-858 3'UTR] X. Worms are slow growing, with reduced brood size and become sterile at elevated temperatures. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. RFP expression in muscles. Reference: Gonzalez-Sandoval A, et al. Cell. 2015 Dec 3;163(6):1333-47. doi: 10.1016/j.cell.2015.10.066. PMID: 26607792.
GW398 C. elegans gwIs39 gwIs34 unc-119(ed3) III. Show Description
gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. gwIs34 [myo-3::mCherry + 256xlacO + unc-119(+)] III. Superficially wild-type. Expresses GFP-LacI throughout development from early embryogenesis, forming a small spot at the lacO array. Worms have red muscle (from L1 stage) and green intestine (from late L4 stage). Reference: Meister P, et al. Genes Dev. 2010 Apr 15;24(8):766-82. PMID: 20395364
GW421 C. elegans gwIs39 III; gwIs58. Show Description
gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. gwIs58 [hsp-16.2p::mCherry::256xLacO::4xLexA + unc-119(+)]. Small transgene/large array. Superficially wild-type. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have green intestine (from late L4 stage). Might still carry unc-119(ed3) in background. Reference: Rohner S, et al. J Cell Biol. 2013 Mar 4;200(5):589-604. doi: 10.1083/jcb.201207024. PMID: 23460676
GW513 C. elegans gwIs39 III; ygIs2; caIs3. Show Description
gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. ygIs2 [baf-1::GFP::lmn-1(Y59C) + unc-119(+)]. caIs3 [pha-4::lacZ + rol-6(su1006)]. Rollers. Strain expressing low level of GFP::LMN-1 (carrying the Y59C mutation). Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have red muscle (from L1 stage) and green intestine (from late L4 stage). Reference: Mattout A, et al. Curr Biol. 2011 Oct 11;21(19):1603-14. doi: 10.1016/j.cub.2011.08.030. PMID: 21962710
GW566 C. elegans gwIs39 III; gwIs4 X. Show Description
gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. gwIs4 [baf-1p::GFP-lacI::let-858 3’UTR + myo-3p::RFP] X. Superficially wild-type. Expresses GFP-LacI throughout development from early embryogenesis, forming a large spot at the lacO array. Worms have red muscle (from L1 stage) and green intestine (from late L4 stage). Reference: Towbin BD, et al. Cell. 2012 Aug 31;150(5):934-47. PMID: 22939621