Search Strains

More Fields
Strain Species Genotype Add
VC3310 C. elegans srgp-1(gk3385)/nT1 IV; +/nT1 V. Show Description
F12F6.5. Apparent homozygous lethal deletion chromosome balanced by translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, vulvaless nT1 homozygotes, and gk3385 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GAAGTCACTTGAAGCATCAGAAAA. External right primer: TCAGAATCAAGCTTCTTTGTTGAG. Internal left primer: TCAAAAACCAATTTCGTTAGAGC. Internal right primer: TGATTTTTATTGCCTTTTTCCAA. Internal WT amplicon: 2179 bp. Deletion size: 980 bp. Deletion left flank: TATGTAGAAGCAACTGGAGAAGAAATTCCA. Deletion right flank: TTCAAAAATAGTTCATTATCATCCGAAGGA. Insertion Sequence: TAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3327 C. elegans W03F9.1(gk3315) V/nT1 [qIs51] (IV;V). Show Description
W03F9.1. Homozygous lethal or sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3315 homozygotes (late larval arrest or sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAACAACGAACAACCGAGG. External right primer: GCGAAGAAGATGTAGGCGTC. Internal left primer: ATCGGTTTCTCGAGTCCTCC. Internal right primer: AACGAGATTCAAAGCGGAGA. Internal WT amplicon: 2151 bp. Deletion size: 836 bp. Deletion left flank: ACTTCCAGATCAATCTCAGGGATCGACAGA. Deletion right flank: CACTTGTGAATTGCTTAATAATCTGCAAAA. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3365 C. elegans pygo-1(gk3509) IV/nT1 [qIs51] (IV;V). Show Description
C02B10.5. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3509 homozygotes (sterile, eggs don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCGAAATCCACAGAACCG. External right primer: TTGCGGTAGCTTAGGCAGAT. Internal left primer: CCTGAGTCATCTCCTGCACA. Internal right primer: AGAGCGGGATCTGGAAAAAT. WT internal amplicon: 2056 bp. Deletion size: approximately 600 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3366 C. elegans Y62E10A.10(gk3369) IV/nT1 [qIs51] (IV;V). Show Description
Y62E10A.10. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3369 homozygotes (sterile, flaccid). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATCTTTAAAGGCGCAGACGA. External right primer: GCAATGTGAACGTGGACAAC. Internal left primer: CACATTGACTTGATGGCTGG. Internal right primer: CCGATTTATTACTCGACCCG. Internal WT amplicon: 1660 bp. Deletion size: 617 bp. Deletion left flank: AGAGTGATTTTTTTTTAGACAAAAAAATTT. Deletion right flank: CCAGTTCCACCTGCAAGTATTTGTGGTTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3371 C. elegans eat-6(ok1320) V/nT1 [qIs51] (IV;V). Show Description
B0365.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1320 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GATCGGAATGAGATGGGAAA. External right primer: ACCTCAAGCAGGAGGTCAAA. Internal left primer: CGAATCAAGAAACGACGGAT. Internal right primer: CAAGAACGGACCAAATGCTT. Internal WT amplicon: 2957 bp. Deletion size: 780 bp. Deletion left flank: AAATTTATAATGAGATTTAATTGTCTTCTT. Deletion right flank: GACACATCAGATCCAGCAATACCCATAGCA. Insertion Sequence: GAAAAAAACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3461 C. elegans alh-5(gk3382) V/nT1[qIs51] (IV;V). Show Description
T08B1.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3382 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCACCTTTAATAACAATGGGGA. External right primer: CTCCAAGATCTCCCTCTCATGT. Internal left primer: CTTTCCCTACTCGCGCTACTT. Internal right primer: GTGTTGTTTGCCCAAGAATGT. Internal WT amplicon: 1350 bp. Deletion size: 349 bp. Deletion left flank: TTGACAATTGTAACATACTTTGGATCGAAA. Deletion right flank: ATATACCTACGCTACCGTTACAATTTCGCA. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3475 C. elegans eelo-2(gk3391) IV/nT1[qIs51] (IV;V). Show Description
ZK550.3. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3391 homozygotes (sterile, lays no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CACCGATAAGGGACTCGAAA. External right primer: CTCATCCACCACTTGGGTCT. Internal left primer: TTTCCTGTCGGAAAATTCAGTT. Internal right primer: CGACATTTCCATTTCATCTTGA. Internal WT amplicon: 1542 bp. Deletion size: 386 bp. Deletion left flank: TCATCAGAATTTTGATAAATACTTTTAAAA. Deletion right flank: TTTAATTTTTTTTAAAGAAAAATATTCATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3476 C. elegans hsp-1(ok1371) IV/nT1[qIs51] (IV;V). Show Description
F26D10.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1371 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTCTCTCTCCCCCTTTTCGT. External right primer: AATAGCTTCTGCACCGCCTA. Internal left primer: GTTTTCATGCACGGAAAGGT. Internal right primer: CCTCAACCCCTGGCATAATA. Internal WT amplicon: 2566 bp. Deletion size: 1225 bp. Deletion left flank: ACGCAACGTTCTTATCTTCGATCTTGGAGG. Deletion right flank: CCTTCAACCTTAAGCAGACCATTGAGGACG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3477 C. elegans pygo-1(gk3390) IV/nT1[qIs51] (IV;V). Show Description
C02B10.5. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3390 homozygotes (sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCGAAATCCACAGAACCG. External right primer: TTGCGGTAGCTTAGGCAGAT. Internal left primer: CCTGAGTCATCTCCTGCACA. Internal right primer: AGAGCGGGATCTGGAAAAAT. Internal WT amplicon: 2056 bp. Deletion size: 775 bp. Deletion left flank: CGGCGGAGCAAGAGTATTATTATTTCACGT. Deletion right flank: GCTGGAGATGATGGCGAATTCTTCGAATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC36 C. elegans unc-5(gk29) pmk-2(gk21)/nT1 IV; +/nT1 V. Show Description
F42G8.3. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous gk21 hermaphrodites (L1 arrest). gk21 appears to be linked to an uncharacterized unc-5 lesion: complementation tests with unc-5/+; dpy-11/+ males produced viable Unc-5 male and hermaphrodite progeny. Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC362 C. elegans unc-5(e53) IV/nT1 [qIs51] (IV;V); dpy-11(e224) V/nT1 [qIs51] (IV;V). Show Description
Morphological markers unc-5 and dpy-11 balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested nT1 aneuploid progeny, and GFP- unc-5; dpy-11 homozygotes. nT1[qIs51] homozygotes inviable. Pick GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC365 C. elegans +/nT1 IV; mom-2(ok591)/nT1 V. Show Description
F38E1.7, F38E1.9. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous ok591 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3874 C. elegans +/nT1 IV; hmgs-1(gk3838[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 V . Show Description
Recessive lethal deletion balanced by nT1. Deletion of 1177 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTGCGACTTGACGAATTTTATCAAGATTA; Right flanking sequence: ATACGATGTCCTCGTTGTCCGAGCAGAATC. See WormBase Variation gk3838 for details.
VC388 C. elegans cyb-3(gk195) V/nT1 [qIs51] (IV;V). Show Description
T06E6.2, T06E6.3. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploid progeny, and slow-growing GFP- sterile Uncs (gk195 homozygotes). nT1[qIs51] homozygotes inviable. Pick GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3882 C. elegans +/nT1 IV; C50B8.1(gk3855[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 V. Show Description
Recessive lethal deletion balanced by nT1. Deletion of 506 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGCAATAATTTTGGGAAAAAACTCAAATTC; Right flanking sequence: GGGTATGGCTTCTAAACTTGCTATAACTTC. See WormBase Variation gk3855 for details.
VC3885 C. elegans ilys-4(gk3827[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 IV; +/nT1 V. Show Description
Homozygous lethal or sterile deletion balanced by nT1. Deletion of 692 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous nT1 is non-GFP vulvaless hermaphrodite that bags. Left flanking sequence: CTTAATTTTTTAGTGGAAGACGATCATCCA; Right flanking sequence: GGGAACAATTGGATATTGGAAAAGAGTTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC396 C. elegans egl-9(ok478) V/nT1 [qIs51] (IV;V). Show Description
F22E12.4. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploid progeny, and GFP- Egl adults (ok478 homozygotes). nT1[qIs51] homozygotes inviable. Pick GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3975 C. elegans +/nT1 IV; sas-5(gk5038[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 V. Show Description
Recessive lethal deletion balanced by nT1. Deletion of 1442 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCAGCTTCCACAAGAAAGGACAAAACCCC; Right flanking sequence: GGTACCTGAGACTCCAGCTGAACGAGAACG. See WormBase Variation gk5038 for details.
VC3985 C. elegans cfim-2(gk5017[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 IV; +/nT1 V. Show Description
Recessive lethal deletion balanced by nT1. Deletion of 2670 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTGTTTGAGGATTGATGGCTGAATTGGAC; Right flanking sequence: ATTAAATAACACGACTTTCTTCAAATTCAA. See WormBase Variation gk5017 for details.
VC399 C. elegans fntb-1(ok590) V/nT1 [qIs51] (IV;V). Show Description
F23B12.6. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploid progeny, and GFP- ok590 homozygotes (early larval arrest, probably L2). nT1[qIs51] homozygotes inviable. Pick GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC403 C. elegans oig-3(ok616) V/nT1 [qIs51] (IV;V). Show Description
Y50E8A.3. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploid progeny, and GFP- ok616 homozygotes (slow-growing, viable, fertile, some animals slightly Unc). nT1[qIs51] homozygotes inviable. Pick GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC406 C. elegans hrpa-1(ok592) IV/nT1 [qIs51] (IV;V). Show Description
F42A6.7. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploid progeny, and GFP- ok592 homozygotes (extremely slow-growing, nearly sterile, often with vulval blip). Homozygous nT1[qIs51] inviable. Pick WT GFP hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC409 C. elegans tag-115(ok627) IV/nT1 [qIs51] (IV;V). Show Description
JC8.13. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploid progeny, and GFP- ok627 homozygotes (slow-growing, develop into sterile adults). nT1[qIs51] homozygotes inviable. Pick GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC414 C. elegans kup-1(ok454) V/nT1 [qIs51] (IV;V). Show Description
F10C2.2. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploid progeny, and GFP- ok454 homozygotes (Unc, sterile or late larval arrest). nT1[qIs51] homozygotes inviable. Pick GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC418 C. elegans him-3(gk149) IV/nT1 [qIs51] (IV;V). Show Description
ZK381.1. Homozygous viable deletion balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploid progeny, and non-GFP gk149 homozygotes (strongly Him, with small broods and many arrested embryos). nT1[qIs51] homozygotes inviable. Pick GFP WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC419 C. elegans nhr-67(ok631) IV/nT1 [qIs51] (IV;V). Show Description
C08F8.8. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploid progeny, and GFP- ok631 homozygotes (Unc, probable L1 arrest). nT1[qIs51] homozygotes inviable. Pick GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC424 C. elegans bec-1(ok700) IV/nT1 [qIs51] (IV;V). Show Description
T19E7.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok700 homozygotes (variable arrest, from larvae through sterile adult). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC436 C. elegans coq-3(ok506) IV/nT1 [qIs51] (IV;V). Show Description
Y57G11C.11. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploid progeny, and mostly sterile GFP- adults (ok506 homozygotes). nT1[qIs51] homozygotes inviable. Pick GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC457 C. elegans dis-3(ok357) IV/nT1 [qIs51] (IV;V). Show Description
C04G2.6. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploid progeny and GFP- ok357 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC460 C. elegans unc-60(gk239) V/nT1 [qIs51] (IV;V). Show Description
C38C3.5. Homozygous lethal deletion balanced by GFP-marked balancer. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploid progeny, and non-GFP gk239 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC470 C. elegans ima-3(ok715) IV/nT1 [qIs51] (IV;V). Show Description
F32E10.4. Homozygous lethal deletion balanced by GFP-marked balancer. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploid progeny, and non-GFP ok715 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC481 C. elegans plrg-1(ok752) V/nT1 [qIs51] (IV;V). Show Description
D1054.15. Homozygous lethal deletion balanced by GFP-marked balancer. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploid progeny, and non-GFP ok752 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC486 C. elegans hlh-17(ok487) IV/nT1 [qIs51] (IV;V). Show Description
F38C2.2. Homozygous lethal deletion balanced by GFP-marked translocation. Heterozygotes are WT with GFP signal in pharynx, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok487 homozygotes (early larval arrest). qIs51 homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC490 C. elegans lin-40(gk255) IV/nT1 [qIs51] (IV;V). Show Description
T27C4.4a. Homozygous lethal deletion balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP gk255 homozygotes (variable arrest as larva or adult; animals become refractile). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC50 C. elegans cyb-1(gk35) IV/nT1 (IV;V). Show Description
ZC168.4. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous gk35 hermaphrodites (sterile). Sterility seems to be male-rescuable. Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC500 C. elegans kdin-1(ok750) IV/nT1 [qIs51] (IV;V). Show Description
F36H1.2. Homozygous viable deletion balanced with GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok750 homozygotes (viable with small broods and multiple morphological defects, often sterile, sometimes explode at vulva). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC508 C. elegans acl-3(ok726) IV/nT1 [qIs51] (IV;V). Show Description
ZK809.2. Homozygous lethal deletion balanced with GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok726 homozygotes (late larval arrest). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC517 C. elegans bec-1(ok691) IV/nT1 [qIs51] (IV;V). Show Description
T19E7.3. Homozygous lethal deletion balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok691 homozygotes (viable and probably fertile, perhaps slow-growing). Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC520 C. elegans isp-1(gk267) IV/nT1 [qIs51] (IV;V). Show Description
F42G8.12. Homozygous lethal deletion balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP gk267 homozygotes (mid-larval arrest). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC524 C. elegans pas-2(ok679)/nT1 [qIs51] (IV;V). Show Description
D1054.3, D1054.2. Homozygous lethal deletion balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok679 homozygotes (early larval arrest). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC545 C. elegans elo-3(gk236) IV. Show Description
D2024.3. Gro. Deletion may involve chromosome rearrangement, as multiple constructs of gk236/nT1[qIs51] were unstable. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC558 C. elegans frk-1(ok760) IV/nT1 [qIs51] (IV;V). Show Description
T04B2.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok760 homozygotes (probable early larval arrest). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC561 C. elegans abcf-1(ok830) V/nT1 [qIs51] (IV;V). Show Description
F18E2.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok830 homozygotes (probable early larval arrest). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC562 C. elegans rbx-1(ok782) V/nT1 [qIs51] (IV;V). Show Description
ZK287.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok782 homozygotes (variable arrest, larval through adult). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC575 C. elegans egl-9(gk277) V/nT1 [qIs51] (IV;V). Show Description
F22E12.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP gk277 homozygotes (probable early larval arrest). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC587 C. elegans cyl-1(ok816) V/nT1 [qIs51] (IV;V). Show Description
C52E4.6a. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok816 homozygotes (early larval arrest). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC592 C. elegans pmk-1(ok811) IV/nT1 [qIs51] (IV;V). Show Description
B0218.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok811 homozygotes (probable embryonic arrest). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC595 C. elegans tag-191(gk286) V/nT1 [qIs51] (IV;V). Show Description
C53A5.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP gk286 homozygotes (probable larval arrest). nT1[qIs51] homozygotes inviable. Note: occasional adult non-GFP animals or bright GFP animals may be seen. Viable non-GFP animals appear to be rare recombinants, and bright GFP animals generally are nT1[qIs51] homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC597 C. elegans rsp-6(ok798) IV/nT1 [qIs51] (IV;V). Show Description
C33H5.12. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok798 homozygotes (Dpyish, slow-growing, sometimes sterile, some embryonic lethality, various morphological defects). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC599 C. elegans C15H11.9&C15H11.8(gk284) V/nT1 [qIs51] (IV;V). Show Description
C15H11.9, C15H11.8. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP gk284 homozygotes (early larval arrest). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807