D2024.3 Homozygous. Outer Left Sequence: CATTGTTTTGTCGCCTCCTT. Outer Right Sequence: GCCTCTGATGATTAGCCGAA. Inner Left Sequence: ATCGACAACATGGATGCAAA. Inner Right Sequence: ACACAAATCGTCTCTTCCGC. Inner Primer PCR Length: 2148. Estimated Deletion Size: about 1800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

D2024.3. Gro. Deletion may involve chromosome rearrangement, as multiple constructs of gk236/nT1[qIs51] were unstable. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

sIs13363 [rCes D2024.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

C25D7.1. Homozygous viable. Deletion of 584 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Left flanking Sequence: tacaagtattctggaaaaaagccgaaccaa ; Right flanking sequence: tgcaaaaatatcttacCTCTGGATCAATTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.