Strain Information
| Name | VC3975 View On Wormbase Documentation for VC3975 gk5038 sas-5 |
|---|---|
| Species | C. elegans |
| Genotype | +/nT1 IV; sas-5(gk5038[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 V. |
| Description | Recessive lethal deletion balanced by nT1. Deletion of 1442 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCAGCTTCCACAAGAAAGGACAAAACCCC; Right flanking sequence: GGTACCTGAGACTCCAGCTGAACGAGAACG. See WormBase Variation gk5038 for details. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x0 |
| Made by | Vancouver KO Group |
| Laboratory | DM |
| Reference | n/a |
Sign in
or
register an account if you want to order this strain.