Strain Information

Name VC3874   View On Wormbase Documentation for VC3874 gk3838 hmgs-1
Species C. elegans
Genotype+/nT1 IV; hmgs-1(gk3838[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 V .
DescriptionRecessive lethal deletion balanced by nT1. Deletion of 1177 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTGCGACTTGACGAATTTTATCAAGATTA; Right flanking sequence: ATACGATGTCCTCGTTGTCCGAGCAGAATC. See WormBase Variation gk3838 for details.
MutagenCrispr/Cas9
Outcrossedx0
Made byVancouver KO Group
Laboratory DM
Reference n/a
Sign in or register an account if you want to order this strain.