More Fields
Strain Species Genotype
RB1360 C. elegans SSSD1.1(ok1527) X. Show Description
SSSD1.1 Homozygous. Outer Left Sequence: cgaatttcccatgtcagctt. Outer Right Sequence: cgtattcctggctcttcgag. Inner Left Sequence: ggcaagcatgaaaataggga. Inner Right Sequence: acacttgcgaagccaagaat. Inner Primer PCR Length: 2954. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3680 C. elegans T23B12.11(gk3652) V; igcm-2(gk3654) X. Show Description
Homozygous viable. Splicing defect and nonsense allele identified by amplicon sequencing.
VC4055 C. elegans igcm-2(gk5129[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 4249 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGGAGCTGATTTAATATTTGAATGTAAGG; Right flanking sequence: TTATGGTTCGTAATATTTGTTGTTGTTTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.