Search Strains

More Fields
Strain Species Genotype Add
JH3087 C. elegans xpo-2(ax2013) I; unc-119(ed3) orIs1 III; mbk-2(dd5) IV. Show Description
orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
JH3134 C. elegans swan-1(ax2045[V5::swan-1]) V. Show Description
V5 tag inserted at N-terminus of swan-1. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3136 C. elegans swan-1(ax2047[Myc::swan-1]) V. Show Description
Myc tag inserted at N-terminus of swan-1. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3149 C. elegans ltIs37 IV; meg-3(tm4259) meg-4(ax2026) X; axIs1522. Show Description
axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591.
JH3158 C. elegans swan-1&swan-2(ax2071) V. Show Description
Deletion of the operon CEOP 5400, removing both swan-1 and swan-2 (V: 13801593-13807217) and insertion of ATTTGTTCAGACAATAAGCTNGAAATC. No reported phenotype. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3159 C. elegans swan-1&swan-2(ax2072) V. Show Description
Deletion of the operon CEOP 5400, removing both swan-1 and swan-2 (V: 13801629-13807223). No reported phenotype. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3176 C. elegans gtbp-1(ax2029) IV. Show Description
Deletion/insertion (AGCTAGC) of a STOP codon/frameshift near the ATG between IV: 10128909...10128934. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3180 C. elegans nos-2(ax2033) II. Show Description
Maintain at 20C. ax2033 was produced by replacing +16 to +42 with TCGACTCTCGAACGATCGTAATAG in the first exon of nos-2. ax2033 mutants are sterile when fed nos-1 dsRNA. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3182 C. elegans gtbp-1(ax2035[gtbp-1::TetraCys]) IV. Show Description
Maintain at 20-25C. ax2035 was produced by mutation of the sgRNA site and insertion of TetraCys tag at the C-terminus of gtbp-1. Substitution/insertion of the sequence GCAGCATCCTGGGCAGCAATTTTGTCCGGCATTTTGGAAACCGCTGCGCATTCCTCCAC GT between IV: 10127239...10127283. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3184 C. elegans gtbp-1(ax2037([gtbp-1::Myc]) IV. Show Description
Maintain at 20-25C. ax2037 was produced by mutation of the sgRNA site and insertion of Myc tag at the C-terminus of gtbp-1. Substitution/insertion of the sequence CAGATCCTCTTCTGATATCAGTTTTTGTTCATTTTGTCCCGCATTTTGGAAACCGCTAC GCATTCCTCCACGC between IV: 10127239...10127283. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3186 C. elegans gtbp-1(ax2039[gtbp-1::3xFlag]) IV. Show Description
Maintain at 20-25C. ax2039 was produced by insertion of 3xFLAG tag at the C-terminus of gtbp-1 by NHEJ. Substitution/insertion of the sequence CTTGTCATCGTCATCCTTGTAATCGATATCATGATCTTTATAATCACCGTCATGGTCTT TGTAGTCCTCCACGAGGAATGCGTGAGGAAATCGTGGA between IV: 10127239...10127269. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3188 C. elegans mex-5(ax2041[3xFLAG::mex-5]) IV. Show Description
Maintain at 20C. 3xFLAG-tagged MEX-5. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3190 C. elegans mex-5(ax2043[OLLAS::mex-5]) IV. Show Description
Maintain at 20C. OLLAS-tagged MEX-5. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3193 C. elegans nos-2(ax2049[3XFLAG::nos-2]) II. Show Description
Maintain at 20C. FLAG::NOS-2 can be detected from P4 to Z2/Z3 stage. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3195 C. elegans mbk-2(ax2051[V5::mbk-2]) IV. Show Description
V5 tag inserted at the N-terminus of mbk-2 isoform a. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3197 C. elegans gtbp-1(ax2053[gtbp-1::GFP]) IV. Show Description
Maintain at 20-25C. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of gtbp-1 between IV: 10127266...10127267. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3199 C. elegans gtbp-1(ax2055[gtbp-1::GFP]) IV. Show Description
Maintain at 20-25C. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of gtbp-1: ATTTTGTCCCGCATTTTGGAAACCGCTACGCATTCCTCCACGC(GFP) between IV: 10127239-10127283. sgRNA site was mutated to avoid Cas9 re-cutting. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3201 C. elegans fbf-2(ax2057[fbf-2::GFP]) II. Show Description
Maintain at 20-25C. ax2057 was produced by mutation of the sgRNA site and insertion of GFP cDNA at the C-terminus of fbf-2. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of fbf-2: ATCATCGCCGTGACTACCA(GFP) between II:6089145...6089165. sgRNA site was mutated to avoid Cas9 re-cutting. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3203 C. elegans mes-2(ax2059[mes-2::GFP]) II. Show Description
Maintain at 20C. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of mes-2 between II:14388297...14388298. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3205 C. elegans lin-15B(ax2061[lin-15B::GFP]) X. Show Description
Maintain at 20C. Nuclear expression of lin-15B::GFP in oocytes and embryos. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3207 C. elegans deps-1(ax2063[deps-1::GFP]) I. Show Description
Maintain at 20C. GFP inserted at N-terminus of deps-1. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3209 C. elegans mex-6(ax2065[mex-6::GFP]) II. Show Description
GFP-tagged mex-6. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3212 C. elegans gtbp-1(ax2068) IV. Show Description
1.6kb deletion in gtbp-1 between IV: 10127256...10128923. Homozygous viable. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3215 C. elegans gtbp-1(ax2073) IV. Show Description
1.6kb deletion in gtbp-1 between IV: 10127264...10128913 and insertion of NheI restriction site (GCTAGC). Homozygous viable. Reference: Paix A, et al. Genetics. 2014 Sep 23.
JH3225 C. elegans meg-3(tm4259) meg-4(ax2026) X. Show Description
P granule defect. High sterility. Reference: Wang JT, et al. eLife 2014;3:e04591.
JH3247 C. elegans meg-4(ax2080[meg-4::FLAG]) X. Show Description
C-terminal FLAG insertion in endogenous meg-4 locus. Reference: Wang JT, et al. eLife 2014;3:e04591.
JH3248 C. elegans meg-4(ax2081) X. Show Description
Deletion removing 733 base pairs upstream of start and the first 2565 bases of the endogenous meg-4 locus. Reference: Wang JT, et al. eLife 2014;3:e04591.
LX2004 C. elegans vsIs183 lite-1(ce314) lin-15B&lin-15A(n765) X. Show Description
vsIs183 [nlp-3p::GCaMP5::nlp-3 3'UTR + nlp-3p::mCherry::nlp-3 3'UTR + lin-15(+)] X. Integrated transgene using nlp-3 promoter to drive GCaMP5 and mCherry expression in HSN; useful for visualizing and quantitating calcium influx in HSN. Reference: Collins K, et al. Elife. 2016 Nov 16;5. pii: e21126. doi: 10.7554/eLife.21126.
LX2060 C. elegans vsSi32 unc-119(ed3) III. Show Description
vsSi32 [goa-1::GFP + unc-119(+)] III. GOA-1::GFP translational fusion driven by 5kb of goa-1 promoter. Rescues unc-119 locomotion defect. vsSi32 is inserted into the left arm of chromosome III between sequences 5’-tttactgcatactgaacaacaggggaaaagggg-3’ and 5’-tagaattagctgtaagacggcgtctaggttttgca-3’. Reference: Kumar S, et al. G3 (Bethesda). 2021 Aug 7;11(8):jkab167. doi: 10.1093/g3journal/jkab167. PMID: 34003969
LX2071 C. elegans goa-1(sa734) I; vsSi32 III. Show Description
vsSi32 [goa-1::GFP + unc-119(+)] III. GOA-1::GFP translational fusion driven by 5kb of goa-1 promoter. Rescues locomotion and body morphology defects, and partially rescues egg-laying defects seen in goa-1 null mutants. vsSi32 is inserted into the left arm of chromosome III between sequences 5’-tttactgcatactgaacaacaggggaaaagggg-3’ and 5’-tagaattagctgtaagacggcgtctaggttttgca-3’. Reference: Kumar S, et al. G3 (Bethesda). 2021 Aug 7;11(8):jkab167. doi: 10.1093/g3journal/jkab167. PMID: 34003969
MT21910 C elegans lin-15AB(n765) X; nEx2065. Show Description
nEx2065 [gur-3p::GFP + lin-15(+)]. Maintain by picking non-Muv. GFP expression in I2, I4, AVD and PVC. Reference: Bhatla N & Horvitz HR. Neuron. 2015 Feb 18;85(4):804-18. PMID: 25640076.
OG153 C. elegans unc-119(ed3) III; drEx206. Show Description
drEx206 [hsf-1p::hsf-1::YFP::unc-54 3'UTR + unc-119(+)]. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
OH3503 C. elegans otEx2040. Show Description
otEx2040 [hse-5p::GFP + rol-6(su1006)]. Transcriptional hse-5s::GFP fusion.Maintain by picking Rollers.
PHX2015 C. elegans ceh-58(syb2015[ceh-58::GFP]) II. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-58 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
PHX209 C. elegans R12G8.1(syb209) V. Show Description
Complete CRISPR/Cas-9 knock-out (1143bp deletion) of the gene R12G8.1. Homozygous. Superficial wild-type. Primers for crossing: Fwd: agctccggggacatcaaata InFwd: CTGAAAACTCGTCGTAGCCG Rev: tcagaggtccgtggttcaaa Wild-type bands: 402bp, 1427bp. Mutation band: 284bp.
QA269 C. elegans mel-46(yt5) IV; ytEx209. Show Description
ytEx209 contains [mel-46(+) + sur-5::GFP]. Maintain by picking GFP+. Culture at 20°C or higher in order not to lose the transgene. GFP minus worms are Mel or sterile at 25 C (completely penetrant). Strong but not fully penetrant Mel at 15 C. To start a yt5 homozygous culture transfer several GFP minus worms to 15°C.
WB201 C. elegans pat-4(st551) III; zpEx204. Show Description
zpEx204 [pat-4::YFP + pat-3::CFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. zpEx204 produces a fully functional YFP-tagged pat-4 protein that localizes to the dense bodies in muscle cells, and rescues the lethal phenotype of pat-4(st551) homozygous animals. Reference: Mackinnon AC, et al. Curr Biol. 2002 May 14;12(10):787-97.