Search Strains

wrdSi57 [^SEC^eft-3p:TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Pick Rollers to maintain. Pan-somatic expression of TIR1 co-factor for AID, and expression of AID-tagged blue protein in somatic nuclei. Self-excising cassette with Rol and HygroR markers still in strain to facilitate crosses. Heat-shock to remove SEC as described in Dickinson et al. 2015. jsSi1579 is an RMCE landing pad inserted at a sgRNA site 45 bp from the ttTi5605 insertion site. It contains an rpl-28p::GFP reporter flanked by FRT and FRT3 sites and a loxP site (for more details about landing pads, see Nonet, 2020.Genetics or visit https://sites.wustl.edu/nonetlab/rmce/). Reference: Vo AA, et al. MicroPubl Biol. 2021 Aug 3;2021:10.17912/micropub.biology.000425. doi: 10.17912/micropub.biology.000425. eCollection 2021. PMID: 34355140

wrdSi19 [mex-5p::TIR1:F2A:mTagBFP2:AID*::NLS::tbb-2 3'UTR] (I:-5.32). Strain allows germline-specific depletion of NHR-23::AID*LLTEV::3xFLAG using the auxin-inducible degron system. wrdSi19 was made by crossing parental strain KRY87 to JDW83 [wrdSi10 (mex-5p::TIR1:F2A:mTagBFP2:tbb-2 3?UTR+SEC, I:-5.32); him5(e1490) V] and using heatshock to remove the SEC. Reference: Ragle JM, et al. Development. 2020 Nov 27;147(22):dev193862. doi: 10.1242/dev.193862. PMID: 33060131.

wrdSi3 [sun-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Endogenous dpy-27 locus tagged with AID* element and myc to create a conditional allele using the auxin-inducible degron (AID). In absence of auxin, ~40% of worms are male due to him-8(me4) mutation. In the presence of auxin, ~100% of worms are male (hermaphrodite-lethal due to degradation of AID-tagged DPY-27). Reference: Li Q, et al. Inducible degradation of dosage compensation protein DPY-27 facilitates isolation of Caenorhabditis elegans males for molecular and biochemical analyses. bioRxiv 2022.01.27.478040; doi: https://doi.org/10.1101/2022.01.27.478040.

qjIs11 [glr-1p::SVNLS2::TagBFPsyn + ser-2(prom2)::SVNLS2::TagBFPsyn]. peIs3042 [eat-4p::svnls2::TagRFP675syn + lin-44p::GFP]. peIs2100 [H-20p::NLS4::mCherry]. qjIs14 [H20p::NLS::YC2.60]. Suitable for whole-brain calcium imaging. mCherry and YC2.60 expression in almost all head neurons. BFP and RFP are also expressed to annotate neurons. H20p is a pan-neuronal promoter expressed in almost all neurons, GLR glial cells, XXX hypodermal cells, pharyngeal gland cells and HMC cells. Reference: Toyoshima Y et al. BMC Biol. 2020 Mar 19;18(1):30. PMID: 32188430; Shioi G, et al. Genetics. 2001 Apr;157(4):1611-22. PMID: 11290717.

mScarlet-I::AID*::3xFlag tags inserted at the C-terminus of the endogenous ifet-1 locus. wrdSi3 [sun-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Germline and early embryo-specific expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in germline and early embryo nuclei. ifet-1 visualized by mScarlet in oocytes with inducible acute degradation when grown on 4mM auxin. No defect in hermaphrodite embryo viability. Reference: Bhatia P, et al. Life Sci Alliance. 2025 May 29;8(8):e202503387. doi: 10.26508/lsa.202503387. PMID: 40441896.

cpSi171 [vha-8p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in multiple tissues including intestine, hypodermis, and excretory cell.

cpSi172 [myo-2p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in the pharynx.

cpSi174 [myo-3p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Expression of TIR1 co-factor for AID, and tissue-specific AID-tagged blue protein in body wall muscle.

mirSi29 [flp-18p::lox2272::mtagBFP2::tbb-2 3'UTR::lox2272::ACR1::SL2::jRGECO1a::let-858 3'UTR + Cbr-unc-119(+)] II. Blue fluorescence in flp-18 expressing neurons. Combine with CRE driven by a promoter co-expressed in flp-18 expressing cells to switch from blue expression to ACR1 and jRGECO1a expression. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.

mirSi34 [myo-3p::lox2272::mtagBFP2::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::let-858 3'UTR + Cbr-unc-119(+)] II. Blue fluorescence in body wall muscles. Combine with CRE driven by a promoter expressed in desired muscle cells to switch from blue expression to ChR2-HRDC and jRGECO1a expression. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.

mirSi37 [flp-18p::lox2272::mtagBFP2::tbb-2 3'UTR::lox2272::ChRmine::SL2::jRGECO1a::let-858 3'UTR + Cbr-unc-119(+)] II. Blue fluorescence in flp-18 expressing neurons. Combine with CRE driven by a promoter co-expressed in flp-18 expressing cells to switch from blue expression to ChRmine and jRGECO1a expression. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.

Pick TagRFP+ animals to maintain. otEx7057 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B]. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Injected into N2. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2

otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2

otIs670 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2

High incidence of males (Him). otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Not known where otIs669 maps relative to him-5. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2

Maintain at 15C. Temperature-sensitive. Slow growing. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2

otIs696 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B]. Insertion site unknown, but not on LG V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2

High incidence of males (Him). otIs696 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2

wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons. otIs696 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2

Him. [NOTE: strain does not segregate many male progeny.] otIs670 provides a healthier alternative to otIs669, performing better in a variety of phenotypic assays. otIs670 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2

otIs794 [cho-1(fosmid)::NLS::SL2::YFP::H2B + eat-4(fosmid)::SL2::LSSmOrange::H2B + unc-47p::tagBFP2 + cat-1p::mMaroon + rab-3p1::2xNLS::tagRFP]. cho-1 fosmid reporter construct labels cholinergic neurons. eat-4 fosmid reporter construct labels glutamatergic neurons. unc-47p::tagBFP2 reporter (contains -2778 to -1 promoter region) labels GABAergic neurons. cat-1p::mMaroon reporter (contains -1599 to -1) labels monoaminergic neurons. rab-3p::tagRFP (contains -1462 to +2921 of prom1) labels all neurons (pan-neuronal marker). Reference: Leyva-Diaz E & Hobert O. Current Biol. 2022 Mar 3;S0960-9822(22)00262-7. PMID: 35259341

reSi7 [rgef-1p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (I:-5.32). Neuronal-specific expression of TIR1 co-factor with N-terminal GFP::TEV::AID*::FLAG tag inserted into endogenous unc-31 locus using CRISPR/Cas9 can be used for conditional depletion of UNC-31 in the nervous system. crRNA (TTTTCAGGAGGATCATGATT). Reference: Cornell R, et al. J Neurosci. 2022 Oct 26;JN-RM-1368-22. doi: 10.1523/JNEUROSCI.1368-22.2022. PMID: 36302635. NOTE: PCR detection of reSi7 insert using the published primers has been reported to be defective. These primers designed by Sherlyn Wijaya and Claire Richardson to detect ttTi4338 (LG I) also work for reIs7: ttTi4338 (LG I) wrdSi23-F: cttcaaagaaatcgccgac wrdSi23-FP: AACAACGAGACCTACGTCG wrdSi23-R: Ctctaagatgtcggccac (wt ~300bp, mutant ~650bp).

heSi208 [eft- 3p::LoxP::NLS(egl-13)::tagBFP2::tbb-2 UTR::LoxP::NLS(egl-13)::mCherry::tbb-2 3'UTR] V. heSi141 [hlh-8p::CRE] X. Egg laying defective. LoxN sites in the endogenous swsn-4 locus facilitate inducible knockout of swsn-4. he268 he272 homozygotes are Egl since they cannot form a functioning vulva due to swsn-4 inactivated in the mesoderm lineage by hlh-8p::CRE expression. Reference: van der Vaart A, et al. Sci Adv 2020 May 20;6(21):eaay3823. PMID: 32494730

heSi208 [eft- 3p::LoxP::NLS(egl-13)::tagBFP2::tbb-2 UTR::LoxP::NLS(egl-13)::mCherry::tbb-2 3'UTR] V. heSi141 [hlh-8p::CRE] X. he273 he287 homozygotes are Egl since they cannot form a functioning vulva due to swsn-8 inactivated in the mesoderm lineage by hlh-8p::CRE expression. LoxN sites in the endogenous swsn-8 locus facilitate inducible knockout of swsn-8. Reference: van der Vaart A, et al. Sci Adv 2020 May 20;6(21):eaay3823. PMID: 32494730

heSi220 [lin-31p::Cre] X. Vulval lineage is marked through activity of a Cre-dependent reporter (blue-to-red switch). All cells in the animal are expressing BFP, except for vulval cells which are expressing mCherry. he317 was inserted into the cxTi10816 site using CRISPR/Cas9. Reference: van der Vaart A, et al. Sci. Adv. 2020 May; 6(21): eaay3823. PMID: 32494730.

wrdSi51 [mex-5p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). GFP::TEV::AID tag inserted at the N-terminus of the endogenous attf-6 locus facilitates auxin-inducible degradation of GFP::TEV::AID::ATTF-6. Reference: Wang Y, et al. Nucleic Acids Research. 2025 Feb 28; 53(4): gkaf079. doi: 10.1093/nar/gkaf079 PMID: 39945323.