Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
BC3315 C. elegans sDf61 unc-31(e169) IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
BC3316 C. elegans sDf62 unc-31(e169) IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
BC3317 C. elegans sDf63 unc-31(e169) IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
BC3318 C. elegans sDf64 unc-31(e169) IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
BC3319 C. elegans sDf65 unc-31(e169) IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are WT and segregate WT, lethal Uncs (arrest as L1) and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
BC3320 C. elegans sDf67 unc-31(e169) IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are WT and segregate WT and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
BC3499 C. elegans let-297(s1989) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vuls, early larval lethals which are Unc and Twitch, and dead eggs. Maintain by picking WT. Not outcrossed!
BC439 C. elegans sDf7/unc-31(e169) dpy-4(e1166) IV. Show Description
Heterozygotes are WT and segregate DpyUncs and early larval lethals. Heterozygotes twitch in 1% Nicotine. Pick WT to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
BC442 C. elegans sDf10/unc-31(e169) IV. Show Description
Heterozygotes twitch in 1% nicotine. Hets are slow, and are somewhat difficult to distinguish from unc-31 homozygotes. Df/Df homozygotes die as early larvae. Maintain by picking twitchers in 1% nicotine. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to David Baillie.
CB169 C. elegans unc-31(e169) IV. Show Description
Slow moving Unc. Recessive. M-MATING+POOR <1%WT.
CB4374 C. elegans spg- (e2335) III; unc-31(e928) IV. Show Description
Spongy gut, intestine has foamy look, especially in L4; Temperature sensitive-almost normal at 15C; leaky Eat at 20C; Penetrant and sick Eat at 25C. Unc.
CB4391 C. elegans unc-31(e928) unc-26(e2340) IV. Show Description
Unc. Eat.
CB4394 C. elegans eat-1(e2343) unc-31(e928) IV. Show Description
Thin, starved, healthy adults. Retain few eggs. Slow irregular pumping at 16, 20, 25C. Unc.
CB928 C. elegans unc-31(e928) IV. Show Description
Unc-very slow and sluggish. Insensitive to prodding. Egl. Constitutive pharyngeal pumping. Long lived.
CF237 C. elegans muIs2 unc-31(e169) IV. Show Description
muIs2 [mab-5::lacZ + unc-31(+)]. non-Unc.
CF301 C. elegans mab-5(e2088) III; unc-31(e169) IV; him-5(e1490) V; muIs9 X. Show Description
muIs9 [hs-mab-5 + C14G10]. Heat-shock inducible mab-5. C14G10 contains a WT copy of unc-31. muIs9 integrated by gamma irradiation.
CF31 C. elegans lin-22(mu5) IV; him-5(e1490) V. Show Description
Alae-to-ray transformation similar to that of n372 animals.
CF693 C. elegans unc-31(e169) IV; him-5(e1490) V; muIs28. Show Description
muIs28 [mig-2::GFP + unc-31(+)]. muIs28 is not mapped, but probably on LG II by process of elimination.
CGC131 C. elegans mir-248(umn41[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) X. Show Description
mir-248 pre-miRNA deletion allele in which mir-248 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
CHS1263 C. elegans srbc-29(yum2659) srbc-30(yum2660) srbc-31(yum2661) srbc-32(yum2662) srbc-33(yum2663) srbc-34(yum2664) srbc-36(yum2665) srbc-37(yum2666) srbc-38(yum2667) srbc-39(yum2668) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
CSM1362 C. elegans twk-35(mac531) V. Show Description
twk-35 loss-of-function allele. Reference: Zhou C, et al. PLoS Genet. 2022;18: e1010126. doi:10.1371/journal.pgen.1010126. PMID: 35482723.
DA438 C. elegans bli-4(e937) I; rol-6(e187) II; daf-2(e1368) vab-7(e1562) III; unc-31(e928) IV; dpy-11(e224) V; lon-2(e678) X. Show Description
Linkage mapping strain. Maintain at 15C.
DA468 C. elegans unc-31(e928) IV; act-2(ad468) act-3(ad767) V. Show Description
Patchy birefringence in pharyngeal muscles-semidominant.
DA469 C. elegans dpy-20(e1282) unc-31(e928) IV. Show Description
Dpy (ts). Unc.
DA496 C. elegans sDf10 unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, Unc lethals (early larval) and dead eggs. Maintain by picking WT.
DA509 C. elegans unc-31(e928) IV. Show Description
Extensively backcrossed to N2. Background strain for most of the feeding-defective mutant screens.
DR281 C. elegans unc-31(e169) dpy-4(e1166) IV. Show Description
Dpy. Unc-slow moving.
DR282 C. elegans dpy-13(e184) unc-31(e169) IV. Show Description
Dpy. Unc-slow moving.
DR68 C. elegans unc-31(m68) IV. Show Description
Slow movement.
FJ224 C. elegans unc-31(e298) IV; dpy-11(e224) V. Show Description
FX19161 C. elegans dpy-20(tm5940)/tmIn5 IV. Show Description
Homozygous lethal or sterile deletion allele balanced by Unc-marked translocation. Break points: In(mec-3 unc-31) IV. Covered region (Mb) 2.3 (10.5..12.8) Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX19666 C. elegans tmC5 IV. Show Description
Break points: In(C01B10.3 eak-7 In(mec-3 unc-31)) IV. Covered region (Mb) 6.2 (6.6..12.8) Mec Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30140 C. elegans tmC5 [F36H1.3(tmIs1220)] IV. Show Description
Break points: In(C01B10.3 eak-7 In(mec-3 unc-31)) IV. Covered region (Mb) 6.2 (6.6..12.8) Balancer marked with myo-2p::Venus. Mec Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30151 C. elegans tmC9 IV. Show Description
Break points: In(glb-19 lgc-52 In(mec-3 unc-31)) IV. Covered region (Mb) 4.8 (10.5..15.2) Unc Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX30234 C. elegans tmC9 [F36H1.2(tmIs1221)] IV. Show Description
Break points: In(glb-19 lgc-52 In(mec-3 unc-31)) IV. Covered region (Mb) 4.8 (10.5..15.2) Balancer marked with myo-2p::Venus. Unc Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
HCC31 C. elegans hwSi13 II; unc-119(ed9) III. Show Description
hwSi13 [pie-1p::GFP::mex-3(2-636)::pie-1 3'UTR + unc-119(+)] II. Worms are healthiest at 15C. Shift to 25C overnight to increase brightness of GFP. Mos1-mediated single-copy insertion (MosSCI) into EG4322. GFP-tagged transgene expressing truncated MEX-3 that is missing a portion required for protein degradation. GFP::MEX-3(2-636) is extraordinarily stable, persisting in somatic cells through the comma stage (~550 cells) at levels similar to those in 1- and 2-cell embryos. Also detected on P granules through hatching. Reference: Huang NN & Hunter CP. Gene. 2015 Jan 10;554(2):160-73.
JC1225 C. elegans mrp-1(ut153) X. Show Description
Synthetic Daf at 15C when in an unc-31(e169) background.
JC1970 C. elegans tbx-2(ut180) III. Show Description
Synthetic dauer-constitutive with unc-31(e169) or unc-3(e151). Defective in adaptation to benzaldehyde, isoamyl alcohol, and butanone. Normal in adaptation to diacetyl and 2-methylpyrazine. Normal in chemotaxis to volatile and water-soluble chemicals.
JC1971 C. elegans tbx-2(ut192) III. Show Description
Synthetic dauer-constitutive with unc-31(e169) or unc-3(e151). Defective in adaptation to benzaldehyde, isoamyl alcohol, and butanone. Normal in adaptation to diacetyl and 2-methylpyrazine. Normal in chemotaxis to volatile and water-soluble chemicals.
JC2199 C. elegans sdf-9(ut163) V. Show Description
Forms dauer larvae in the unc-31(e169) background at 25C. Forms dauer-like larvae at 25C on NGM plates without cholesterol.
JC2202 C. elegans sdf-9(ut187) V. Show Description
Forms dauer larvae in the unc-31(e169) background at 25C. Forms dauer-like larvae at 25C on NGM plates without cholesterol.
JH1986 C. elegans unc-119(ed3) III; axIs1437. Show Description
axIs1437 [pCG31; LAP::lsm-1 + unc-119(+)]. GFP expression appears granular in somatic blastomeres at the 4-cell stage. Superficially wild-type. Reference: Dev Bio (2008) 323(1):76-87.
JMC231 C. elegans hrde-1(tor125[GFP::3xFLAG::hrde-1]) III. Show Description
GFP and 3xFLAG tags inserted into endgonenous hrde-1 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
KC431 C. remanei Show Description
Caenorhabditis remanei mutant. Small (non-Mab)/Dumpy. Male-female strain.
KG1180 C. elegans lite-1(ce314) X. Show Description
Defective response to short wavelength light; response strongly reduced but not eliminated. All other characteristics seem wild type, including reponse to mechanosensory stimuli. Strong, probably null, allele. This mutation also blocks the coordinated light response of unc-31(e928) and egl-30(ad805). To identify lite-1 homozygous mutants when crossing into different backgrounds, use a fluorescence stereomicroscope with a GFP filter and zoom to the hightest magnification (60-100X) to distinguish Lite from non-Lite animals. This works best when the animals are mired in thicker parts of the food to slow their spontaneous locomotion but not their response to light. Scan animals around the edge of the food where it is thickest. Leave the lid of the plate off for a minute or so before starting to let the animals adjust to air currents.
LP184 C. elegans mom-5(cp31[mom-5::YPET + LoxP]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
MLC1776 C. elegans tbx-43(luc131) III. Show Description
Wild-type morphology. CRISPR/Cas9 engineered 952 bp deletion of the tbx-43 locus. Flanking sequence: aattagtttttagctccagaagtcggggccgcgccacgttgcatgctcgg / ggcgcttatggaaaaatcattgtggcgggaattcgattcgcagtgtaatg Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421
MT1207 C. elegans unc-31(n577) IV. Show Description
Temperature sensitive. pka egl-22.
MT1784 C. elegans dpy-20(e1362) unc-31(e169) IV. Show Description
Dpy. Unc.
MT2940 C. elegans unc-31(n1304) IV. Show Description
Temperature sensitive.