Strain Information
Name | RG5028 View On Wormbase |
---|---|
Species | C. elegans |
Genotype | ZC434.4(gk5836[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. |
Description | umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5836 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4768 and CGC92. gk5836 is a 1235 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CTCCATTCTTGATATGCAATGTTTTTTAAA; Right flanking sequence: TGGGCTAAGAGTTCCGATGCACCCTCGGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
Mutagen | Crispr/Cas9 |
Made by | Morgan Zaic |
Laboratory | RG |
Sign in
or
register an account if you want to order this strain.