Strain Information

Name RG5006   View On Wormbase
Species C. elegans
Genotypestip-1(gk5457[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II.
DescriptionumnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5457 homozygotes), and paralysed DpyUnc mKate2+ (mnC1). Derived from parental strains VC4376 and CGC48. gk5457 is a 3229 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTGGTGCCATTGGTGGTGGTGGAGCCATTG; Right flanking sequence: TTTGGCTGCATGTTGTTTAGTGGCATGCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
MutagenCrispr/Cas9
Made byMorgan Zaic
Laboratory RG
Sign in or register an account if you want to order this strain.