Search Strains

dnSi9 [sup-46::GFP::sup-46 3’UTR + Cbr-unc-119(+)] inserted into ttTi5605 on LG II. Strong nuclear-localized GFP expression (expression from dnIs22 is brighter).

dnIs24 [sup46::flag::mCherry + Cbr-unc-119(+)]; site of integration unknown. Strong nuclear-localized mCherry.

oxIs318 [spe-11p::mCherry::histone + unc-119(+)] II. ruIs32 [pie-1p::GFP::histone H2B + unc-119(+)] III. ddIs6 [tbg-1::GFP + unc-119(+)] V. dnIs17 [pie-1p::GFP::hPLCIII?PH domain + unc-119(+)]. Maintain under normal conditions. Pick GFP+ to maintain. Reference: Johnston et al. (2010) Curr Biol.

tnIs13 [pie-1p::vab-1::GFP + unc-119(+)].

tnIs13 [pie-1p::vab-1::GFP + unc-119(+)]. ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)].

tnIs13 [pie-1p::vab-1::GFP + unc-119(+)]. ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)]. Homozygous hT2[bli-4 let-? qIs48] are inviable. Homozygous fog-3(q443) animals are females.

tnIs13 [pie-1p::vab-1::GFP + unc-119(+)]. Homozygous hT2[bli-4 let-? qIs48] are inviable. Homozygous fog-3(q443) animals are females.

tnEx159 [sacy-1p::GFP::sacy-1 + unc-119(+)]. Pick wild-type to maintain. Transgene rescues sacy-1(tm5503) sterility. Reference: Kim S, et al. 2012 Genetics

tiar-1(tn1543[loxP::Cbr-unc-119(+)::loxP]) II. Reference: Huelgas-Morales G., et al. G3 (Bethesda). 2016 Apr 7;6(4):1031-47.

uwaEx1 [eft-3p::CERULEAN-VENUS::lgg-1 + unc-119(+)]. Pick non-Unc to maintain. Ubiquitously-expressed lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaSi5 [myo-3p::CERULEAN-VENUS::lgg-1 + unc-119(+)] II. MosSCI insertion into ttTi5605 II. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in body wall muscle. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaEx6 [rab-3p::CERULEAN-VENUS::lgg-1 + unc-119(+)]. Pick non-Unc to maintain. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in neurons. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaEx8 [eft-3p::CERULEAN-VENUS + unc-119(+)]. Pick non-Unc to maintain. Ubiquitously-expressed oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaEx8 [eft-3p::CERULEAN-VENUS::tomm-7 + unc-119(+)]. Pick non-Unc to maintain. Ubiquitously-expressed tomm-7 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaSi1 [eft-3p::CERULEAN-VENUS::lgg-1 + unc-119(+)] II. MosSCI insertion into ttTi5605 II. Ubiquitously-expressed lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaEx4 [ubc-18::GFP::HA + myo-3p::RFP + unc-119(+)]. Pick RFP+ animals to maintain. Translational GFP transgene rescues ubc-18(tm5426).

uwaEx2 [vha-6p::CERULEAN-VENUS::lgg-1 + unc-119(+)]. Pick non-Unc to maintain. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in the intestines. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaSi2 [vha-6p::CERULEAN-VENUS::lgg-1 + unc-119(+)] II. MosSCI insertion into ttTi5605 II. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in the intestines. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaEx3 [dpy-7p::CERULEAN-VENUS::lgg-1 + unc-119(+)]. Pick non-Unc to maintain. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in the hypodermis. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaSi3 [dpy-7p::CERULEAN-VENUS::lgg-1 + unc-119(+)] II. MosSCI insertion into ttTi5605 II. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in the hypodermis. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaEx4 [myo-2p::CERULEAN-VENUS::lgg-1 + unc-119(+)]. Pick non-Unc to maintain. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in pharyngeal muscle. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaSi4 [myo-2p::CERULEAN-VENUS::lgg-1 + unc-119(+)] II. MosSCI insertion into ttTi5605 II. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in pharyngeal muscle. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

uwaEx5 [myo-3p::CERULEAN-VENUS::lgg-1 + unc-119(+)]. Pick non-Unc to maintain. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in body wall muscle. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.

krIs14 [hsp-16.48p::MosTransposase + lin-15(+) + unc-122p::GFP] V. Recessive Unc. unc-5(lib1) is a CRISPR/Cas9 engineered mutant carrying the Intersister/Intrachromatid Repair Assay (ICR Assay) cassette inserted into the endogenous unc-5 locus. Briefly, ICR assay cassette includes two tandem GFP cassettes: the upstream using the myo-3 (body wall) promoter with a truncated GFP coding sequence, and the down-stream using the myo-2 (pharynx) promoter with GFP coding sequence interrupted by a Mos1 Drosophila transposon. Excision of Mos1 yields a single DSB, which if repaired by intersister or intrachromatid recombination, then will yield GFP+ progeny. The krIs14 insertion carrying heat-shock inducible Mos1 transposase is marked with coelomocyte GFP expression. Reference: Toraason E, et al. Current Biology 2021. https://doi.org/10.1016/j.cub.2021.03.008

Intragenic revertant (ra202) of original unc-112 mutation. WBPaper 00005804.

Y102F5A.1. Deletion extents determined by oligo array CGH. Deletion size: ~14kb. Deletion left flank: GGCAATCCTGGCCGAAGCTTTGAAACGCCCGAGTAAAGCCAAGAAGCGTC. Deletion right flank: GTTGTCTTTATCGAACCGCGTTGTTGAACTGTTGCATGAATCATGATTTC. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.

The unc-112(r367); raDf4/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf4 homozygotes arrest as L2 larvae. raDf4 deletes dim-1.

The unc-112(r367); raDf6/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf6 homozygotes arrest during embryogenesis. raDf6 deletes dim-1.

raDf7 suppresses the paralyzed phenotype of unc-112(r367) because the deficiency deletes the dim-1 gene. Reduction or loss of the dim-1 gene product suppresses the unc-112(r367) phenotype. In this strain: Animals homozygous for raDf7 arrest as L1 or L2 larvae; Animals without raDf7 are paralyzed as adults; Animals heterozygous for raDf7 move reasonably well.

The unc-112(r367); raDf9/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf9 homozygotes arrest as L1 or L2 larvae. raDf9 deletes dim-1.

The unc-112(r367); raDf10/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf10 homozygotes arrest as L1 or L2 larvae. raDf10 deletes dim-1.

The unc-112(r367); raDf11/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf11 homozygotes arrest as L1 or L2 larvae. raDf11 deletes dim-1.

The unc-112(r367); raDf12/+ hermaphrodites move better than unc-112(r367); +/+ animals (but not as well as WT). raDf12 homozygotes arrest as L1 or L2 larvae. raDf12 deletes dim-1.

raEx11 [(pDM#208) unc-112(+) + rol-6(su1006)]. Maintain by picking Rollers. raEx11 rescues the r367 phenotype. Segregates Unc-112 and Rollers.

raEx16 [unc-112::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. raEx16 produces a fully functional GFP-tagged unc-112 protein that localizes to the dense bodies and M-line in muscle cells, and rescues the lethal phenotype of unc-112(st581) homozygous animals. Reference: Rogalski TM, et al. J Cell Biol. 2000 Jul 10;150(1):253-64.

C47E8.7. Heterozygotes are WT and segregate WT, Pat unc-112 homozygotes and Unc homozygotes. Pick WT to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

raEx16 [unc-112::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. raEx16 produces a fully functional GFP-tagged unc-112 protein that localizes to the dense bodies and M-line in muscle cells, and will rescue the lethal phenotype of unc-112(st581) homozygous animals. Reference: Rogalski TM, et al. J Cell Biol. 2000 Jul 10;150(1):253-64.

raIs8 [unc-112::GFP + rol-6(su1006)]. Rollers. raIs8 produces a fully functional GFP-tagged UNC-112 protein that localizes to the dense bodies and M-line in muscle cells. Derived by integrating raEx16 in DM7016.

edIs6 [unc-119::GFP + rol-6(su1006)] IV. Strong Roller phenotype. Hets are not Rollers (despite the presence of the supposedly dominant su1006 mutation in the array), so heterozygous males mate well. edIs6 is the integration of an array carrying pDP#MMUGF12 and pRF4. pDP#MMUGD12 ia an unc-119::GFP fusion that encodes 101 aa of UNC-119 and was made from the Fire lab vector pPD95.77. pRF4 is the rol-6(su1006) plasmid that gives a Rol phenotype. This strain allows the nervous system to be visualized by GFP fluorescence. GFP expression starts in the early embryo and continues through adulthood in most, if not all, of the nervous system. The expression of a similar lacZ fusion (but carrying a nuclear localizing signal) is described in Genetics 141: 977-988 1995.

Unc. Contains an unlinked dauer constitutive mutation. See HT1593 for a stock with the Daf mutation removed.

icbSi228 [ttTi5605_right::wrt-2p::wCherry::Dam:linker:egl-13NLS::vhhGFP4::unc-54::unc-119 3'UTR::unc-119::unc-119p::ttTi5605_left)] II. Wild-type growth and movement.

icbSi228 [ttTi5605_right::wrt-2p::wcherry::Dam:linker:egl-13NLS:vhhGFP4::unc-54::unc1193'UTR::unc-119::unc-119p::ttTi5605_left)] II. Wild-type growth and movement.

qaIs8001 [fhod-1::GFP + unc-119(+)]. Integrated functional translational FHOD-1::GFP fusion. Superficially wild-type. Reference: Mi-Mi L, et al. J Cell Biol. 2012 Jul 9;198(1):87-102. doi: 10.1083/jcb.201202053.

syIs80 [(pPGF11.13) lin-11::GFP + unc-119(+)] III. Animals are Unc. GFP fluorescence is observed in vulval cells, uterine pi cells and VC neurons.

ezIs2 [fkh-6::GFP + unc-119(+)]. ezIs2 was integrated with pPD95.69 (fkh-6 promoter and unc-54 3') and pMM106b (unc-119(+)). Worms are 100% non-Unc (the unc-119 background has been crossed out). GFP expression in adult hermaphrodite spermatheca is bright and weak staining is also observed in the proximal sheath cells. Weak GFP staining is also observed in Z1/Z4 cells in both sexes.

ezIs10 [(pWY3) lin-32::GFP + unc-119(+)].

fkh-6(ez73[3xflag + Cbr-unc-119(+)]) II.

tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III. zuIs236 [his-72(1 kb 5'UTR)::BIRA::GFP::his-72(1 kb 3'UTR) + unc-119(+)]. Location of zuIs236 is not known, but is not in LG III.

eagIs6 [spn-4p::jGCaMP7s::pie-1 3'UTR + HygR [*fxIs10] ] II. ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)]. CaFE reporter (calcium inducible fluorescence in germline). Calcium-inducible fluorescent jGCaMP7s protein codon-optimized for elegans and expressed in germline enables visualization of calcium wave upon fertilization. H2::mCherry marks germline nuclei. Reference: Toperzer KM, et al. Biol Open. 2023 Sep 15;12(9):bio059832. PMID: 37602653.

eagIs6 [spn-4p::jGCaMP7s::pie-1 3'UTR + HygR [*fxIs10] ] II. ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)] IV. CaFE reporter (calcium inducible fluorescence in germline). Calcium-inducible fluorescent jGCaMP7s protein codon-optimized for elegans and expressed in germline enables visualization of calcium wave upon fertilization. mCherry::PH marks cell membranes. Reference: Toperzer KM, et al. Biol Open. 2023 Sep 15;12(9):bio059832. PMID: 37602653.