Search Strains

This strain is homozygous for a deletion (gk3284) in K07G5.1, detectable by PCR using the following primers. External left primer: TTGCCTTTTGTAGATGTGATAGGA. External right primer: TAATCCGAAAGTCACAAAATCTGA. Internal left primer: GTCCCCACAGATGACGTTCT. Internal right primer: CCTTGCATCAGCTTTTCACA. Internal WT amplicon: 1884 bp. Deletion size: 608 bp. Deletion left flank: TTGAGCTCTTCGAGACACTGAAAATGAGAT. Deletion right flank: CTAGAAAAATTTAATTTTAAGTCAAGCATA. Validation: gk3284 passed by CGH. Other deletion (gkDf32) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3123) in C03G5.7, detectable by PCR using the following primers. External left primer: CCTTCTATTCCCCCAGAGGCTTAC. External right primer: CGTTTGTCACCACTTCCCTATCC. Internal left primer: GGGTCGTGTGACGAATTGCGC. Internal right primer: AACCGTAATAGAAGACAGGGAGGTG. Internal WT amplicon: 3658 bp. Deletion size: 1513 bp. Deletion left flank: ACAGAAAAAAAAACACAAAAAACCAAAACT. Deletion right flank: TGGGTTAGTATTTCAAGAAAATAATTTTTT. Validation: gk3123 passed by CGH. Other deletion (gk3259) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K07G5.1. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk3542 homozygotes (sterile, lays some eggs but none hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTGCCTTTTGTAGATGTGATAGGA. External right primer: TAATCCGAAAGTCACAAAATCTGA. Internal left primer: GTCCCCACAGATGACGTTCT. Internal right primer: CCTTGCATCAGCTTTTCACA. Internal WT amplicon: 1884 bp. Deletion size: approximately 1125 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K01G5.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W04G5.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Nonsense allele and splicing defect identified by amplicon sequencing.

Homozygous viable. Deletion of 2446 bp with Calarco/Colaiacovo selection cassette conferring myo-3::GFP and G418 resistance inserted at break. Left flanking sequence: GCGGTTGAAAATGTTCGATTGTTTCCAGCC. Right flanking sequence: GAGGGTATGGGACAAATCTCTTAATTGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 10206 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AATTCGATGCCAAATCATGTGGCAGCTCAA. Right flanking sequence: GGGGAATTCGAATTTCTTAATGGCTTGTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1257 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCGAACAAAAGTCTCAAAAATGCTTTCACC; Right flanking sequence: ACCGTATCAAATACGACATCAACACCATCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 689 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GGCGCCATGGAAATCATTTTTCAAATTGTC. Right flanking sequence: TACGGAGCAGGTTGGAGAGCATTGAGCTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 593 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTTATTAGAAGTACAGGATTTTCAAGCTAC. Right flanking sequence: TTTTGCAAGATATTTTAATGATTGAAACAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

C13G5.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok841 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

okIs53 [Pharyngeal GFP marker] III. M01G5.5. WT with semi-dominant GFP expression in pharynx. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K01G5.6. Homozygous viable or sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk318 homozygotes (often sterile, lays eggs that don't hatch; some eggs hatch and develop to fertile adulthood). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C01G5.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K01G5.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1401 homozygotes (Dpy, mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 1364 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGATTTCGAATCAAATCTTATTTTTTCTTC; Right flanking sequence: TCGTCAAAATGCGTCTCCAAATGTATAAAA. sgRNA #1: TTCTTCTTCGAAACACTCGG; sgRNA #2: ACTCGAGCAATTCAGACTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Heterozygotes are WT and segregate WT and Sterile Dpys. Homozygous rib-2(qa4900) animals give homozygous F2 animals that can develop to the adult stage but exhibit abnormal phenotypes such as egg-laying defects, increased body width, and reduced activity in movement. While the F2 qa4900 homozygotes are fertile, the F3 qa4900 homozygous progeny stop developing during gastrulation and fail to develop normally. 511 bp deletion in the region of intron2 to exon 6 of the rib-2 gene (K01G5.6).

Maintain at 15C. Temperature-sensitive dauer constitutive: 100% dauers at 25C, leaky at 20C. Dpy. Crowds.

sEx10434 [rCes Y46G5A.17::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx14858 [rCesY46G5A.30::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi453 [nhr-82p::FLP_CAI_G5D + unc-119(+)] IV. Heat shock produces green nuclei in the seam cell lineage and red nuclei elsewhere. Might still carry unc-119(ed3) III in background.

rg551 is an endogenous genomic CRISPR/Cas9 knock in of YFP fused to the C-terminus of the gene pck-2 in N2 background. Robust YFP fluorescence body wall muscle, intestine, hypodermis and pharyngeal muscle. Him. Reference: Goncalves J, et al. iScience 2020 Mar 19;23(4):100990. PMID: 32240955

rgEx180 [aex-3p::daf-2(+) + tnt-4p::GFP]. rgEx180 reduces unc-103(n1213)-induced spicule protraction, and rescues constitutive dauer formation.

Heterozygotes are WT and segregate WT, Dpy Steriles and Uncs which arrest in the L1 stage.

gsgIs8 [synthetic 900 bp HA1 left::dpy-10 cRNA site:: synthetic 900 bpHA2 right] (X: 798667). Superficially wild-type. gsgIs8 can be used to generate single-copy insertions in C. elegans Chromosome X. This strain is part of the SKI PLACE System, which can be used to generate single-copy insertions into the C. elegans N2 genome at specific safe harbor locations on each chromosome through CRISPR-Cas9-mediated insertion. The system uses a single plasmid, pSKI (Addgene #232484), to insert transgenes at specific genomic locations. Generated in N2 background. Reference: Dinneen E, et al. G3 (Bethesda). 2025 Sep 19:jkaf220. doi: 10.1093/g3journal/jkaf220. PMID: 40973646.

Maintain by mating females with males.

Maintain by mating GFP+ females with GFP+ males.

Unc. Not caused by cxTi10882. EG5003 contains background mutations (partial deletion of pgp-6 and pgp-7 and a deletion close to cTel3x.1). EG6250 is an outcrossed version of this strain. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat).

oxIs351 contains [unc-47p::channelrhodopsin::mCherry + lin-15(+) + Litmus]. Superficially wild-type.

oxIs353 contains [myo-3p::channelrhodopsin::mCherry + lin-15(+) + Litmus]. Superficially wild-type.

oxIs363 [unc-122p::GFP + unc-119(+)]. Wild type. Very dim GFP expression in the coelomycytes. Only visible on compound microscope. Plasmid pBN04 inserted by MosSCI into cxTi10882 site.

oxIs364 contains [unc-17p::channelrhodopsin::mCherry + lin-15(+) + Litmus]. Superficially wild-type.

Caenorhabditis sp. 9 Male-female strain. Isolated from a sample collected by Joel Ehrenkranz on May 20, 2008, around 11 AM in Shinkolobwe, Katanga Province, Democratic Republic of the Congo (~11°S, 26°E). The sample was collected from worked soil which contained organic material around the foundation of a wattle hut. This time of year was the dry season in Katanga Province, so daytime temperatures were in the high 70s and nighttime temperatures in the low 50s. The specimen was placed in a ziplock bag with a slice of apple for transport to Susan Mango's lab at the Huntsman Cancer Institute, Salt Lake City, Utah. From the date of collection until the specimen reached the lab was approximately 2 weeks.

oxIs494 [peel-1p::GFP::peel-1 3'UTR + Cbr-unc-119(+)] II. GFP is expressed in the spermatogenic germline. During spermatogenesis, GFP remains in the residual body and is not packaged into sperm. Reference: Seidel HS, et al. PLoS Biol. 2011 Jul;9(7):e1001115.

Unmotivated locomotion, egg-laying defect, weak Hid phenotype. 4X outcrossed for autosomes, 2X outcrossed for the X chromosome. Reference: Ailion M, et al. Neuron. 2014 Apr 2;82(1):167-80.

dpy-13(ox495::Cbr-unc-119(+) + myo-2p::mCherry + unc-122p::GFP) IV. Dpy, mCherry pharyngeal muscle, dim GFP+ in coelomycytes. Insertion/deletion into cxTi10882 MosSCI site on Chr. IV. Can be used as balancer.

Caenorhabditis sp. 14 Male-female strain. Isolated from a rotten horse chestnut (Tahitian chestnut?) collected by David Ailion on the island of Moorea (17.53 S, 149.83 W) on July 24, 2009.

qqIr7 [peel-1(qq99)] I. oxSi78 [peel-1p::peel-1 (introns included)::GFP::peel-1 3'UTR + Cbr-unc-119(+)] II. Genetic background is a mixture of N2 and wild isolate EG4348. The oxSi78 insertion produces a PEEL-1::GFP translational fusion. PEEL-1::GFP is expressed in the spermatogenic germline and packaged into sperm. PEEL-1::GFP appears to localize to fibrous body-membranous organelles. PEEL-1::GFP does not rescue peel-1(qq99). Reference: Seidel HS, et al. PLoS Biol. 2011 Jul;9(7):e1001115.

oxSi87 [peel-1p::N-terminal 12 amino acids of PEEL-1::GFP::peel-1 3'UTR + Cbr-unc-119(+)] II. GFP is expressed in the spermatogenic germline. During spermatogenesis, GFP is packaged into sperm. Reference: Seidel HS, et al. PLoS Biol. 2011 Jul;9(7):e1001115.

oxSi120 [peel-1p::tagRFP::msp-142 3'UTR + unc-119(+)]. Reference: Batchelder EL, et al. Proc Natl Acad Sci U S A. 2011 Jul 12;108(28):11429-34.

Caenorhabditis sp. 14 Male-female strain. Made by inbreeding EG5716 for 30 generations by picking a single L4 female and male at each generation.

Temperature sensitive. Maintain at 15C. 100% arrest at 25C. Some growth at 20C.

Temperature sensitive. Maintain at 15C. Will also grow at 20C, but not 25C.

Temperature sensitive, maintain at 15C. At 25C the eggs arrest at lima bean and have normal gut granule birefringence. Will grow at 20C.

ts embryonic lethal. Grows at 15C.

Temperature sensitive. Maintain at 15C. Will grow at 20C, but not 25C.

Mutation resulted from the imprecise loss of pk37::Tc1. Incompletely penetrant sterile and lethal. Defects in oocyte cell cycle arrest, gonad migration, and hypodermal differentiation. See also WBPaper00002965.

mg54 almost completely suppresses the daf-c phenotype of daf-2. 0.4% dauers.