Search Strains

vpIs1 [lin-15(+) + elt-3::GFP].

K01G5.2 Homozygous. Outer Left Sequence: TTTTTACGGGCGAAATTCAG. Outer Right Sequence: AATTCAGTGATGACACGGCA. Inner Left Sequence: AATTTGTCGATGCACCATGA. Inner Right Sequence: CAGTCGGTGAGTTTGGGAAT. Inner Primer PCR Length: 2358. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C01G5.6 Homozygous. Outer Left Sequence: caaacattttgcgtcggaat. Outer Right Sequence: tcggaatttcttgtccgttc. Inner Left Sequence: tccttgtcatcgttttgcac. Inner Right Sequence: tcagcttgaacattgctgct. Inner Primer PCR Length: 2131. Estimated Deletion Size: about 850 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C08G5.5 Homozygous. Outer Left Sequence: attgggggattttccaagac. Outer Right Sequence: actagttttgggcatggtgc. Inner Left Sequence: ccgcgagcaaaatacctaaa. Inner Right Sequence: gctttaagcttcggctgttg. Inner Primer PCR Length: 2200. Estimated Deletion Size: about 750 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T08G5.2. Homozygous. Outer Left Sequence: AACGGATTTCGCATCGTAGT. Outer Right Sequence: GCCTGCGGTAAGAAACAGAG. Inner Left Sequence: ATTTTTGAAAGCAGCAACGC. Inner Right Sequence: TCAAATTCTTTGGAATCGCC. Inner Primer PCR Length: 3004 bp. Deletion Size: 860 bp. Deletion left flank: CATGATGGTTTTCATTGTCGTGTGTGGAGT. Deletion right flank: TTGAAACAAAAATGAGCAAGTATTAGAGAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T08G5.15. Homozygous. Outer Left Sequence: AACGGATTTCGCATCGTAGT. Outer Right Sequence: GCCTGCGGTAAGAAACAGAG. Inner Left Sequence: ATTTTTGAAAGCAGCAACGC. Inner Right Sequence: TCAAATTCTTTGGAATCGCC. Inner Primer PCR Length: 3004 bp. Deletion Size: 1240 bp. Deletion left flank: AGGTTAATTATTTTCCGAAAACTCTGTAAC. Deletion right flank: CTACAAATCATCTTTTTATCGTCAAAAATT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T22G5.5. Homozygous. Outer Left Sequence: TACTTTGCGCTTCTTACCCG. Outer Right Sequence: GCAGAATTGGTGGGAAATGT. Inner Left Sequence: CTTGGTGTCCCTTTCGTGTT. Inner Right Sequence: AGGGCAAGAATTGGGGTAAT. Inner Primer PCR Length: 3244 bp. Deletion Size: 1585 bp. Deletion left flank: GTATTTTGGCTTGTCCAATTGAATATTACA. Deletion right flank: GTTTTGAAAAATTACGAGCTTGTTCCAATA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T02G5.1, T02G5.13. Homozygous. Outer Left Sequence: TGATTGGTGCACTGGTCATT. Outer Right Sequence: AATCACGATACCTTGGACGC. Inner Left Sequence: TCGTTTCGAAATTCGTCCTC. Inner Right Sequence: ATGCCTGGTGACGACTACCT. Inner Primer PCR Length: 2798 bp. Deletion Size: 1381 bp. Deletion left flank: GTTTATACTCTGGAAAAAGTTACAAAATCA. Deletion right flank: GTGGGATCAATTGTTAAAACTGCAACTTTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T23G5.6. Homozygous. Outer Left Sequence: AGAAATGGATGGAAGCAACG. Outer Right Sequence: TAGGTGAGGGAAGTGCTGCT. Inner Left Sequence: AAACATTGCCCTGCAAAAAG. Inner Right Sequence: GCGATGCGATTTAGAGCAAT. Inner Primer PCR Length: 1281 bp. Deletion Size: 891 bp. Deletion left flank: ACGTGATAAAAAGGAACAAAATGGATATGG. Deletion right flank: GATGACAAAAATATTCTACATGAGCAAAAT. Insertion Sequence: ATATG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T02G5.3 Homozygous. Outer Left Sequence: ccgaatgcctgaatatcaca. Outer Right Sequence: tcgtcctcttccacttttgg. Inner Left Sequence: tctaactatgctcggccacc. Inner Right Sequence: tccgagaccggctaccttat. Inner Primer PCR Length: 1158. Deletion size: about 500bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C08G5.4 Homozygous. Outer Left Sequence: gagaaatagacaggtgcggc. Outer Right Sequence: gttgtggcactacaaggggt. Inner Left Sequence: aaaaatcaccattttgggca. Inner Right Sequence: ccgtgcaaatttctcactca. Inner Primer PCR Length: 1165. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T02G5.7 Homozygous. Outer Left Sequence: cagtctatcgcaatgtcgga. Outer Right Sequence: ggagttgacgattcggagac. Inner Left Sequence: ccgaggatctttcgctaactt. Inner Right Sequence: tttccgaaaacgctcactg. Inner Primer PCR Length: 1134. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C09G5.8 Homozygous. Outer Left Sequence: ttgtttgcaacttccgtgag. Outer Right Sequence: agggtttgcggcttctattt. Inner Left Sequence: tataaccagggatttcggca. Inner Right Sequence: tttgtgtcaaaacatgaaaagc. Inner Primer PCR Length: 1282. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T21G5.3. Homozygous. Outer Left Sequence: agtgcatttggaggatcagg. Outer Right Sequence: aaagagtttgcgcgtcattt. Inner Left Sequence: cgatcgagtgactgtccaga. Inner Right Sequence: ttcaattgcagacttcgtcg. Inner primer WT PCR product: 2952. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T20G5.5. Homozygous. Outer Left Sequence: TGGCCACAGCTCTTTTCTTT. Outer Right Sequence: GGGAAAACTCACGGTTTTGA. Inner Left Sequence: GTGGAGGAAGACCGTGTTGT. Inner Right Sequence: TGCCACTGATGAAAGGAGTG. Inner Primer WT PCR product: 3313. Deletion size: 999 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K07G5.2. Homozygous. Outer Left Sequence: TGAGCGAGGAGAAAGAGAGC. Outer Right Sequence:AAAAACGACACGATAACGGC. Inner Left Sequence: AGATAGCCGGAATAGCTGGC. Inner Right Sequence: CTGGAGCCAATCCAACTGAT. Inner primer WT PCR product: 2133. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W04G5.6 Homozygous. Outer Left Sequence: GCAATCGGCATCAAGAAGAT. Outer Right Sequence: GAATTTTTCCCCGTTTGGAT. Inner Left Sequence: GAGAAAAGCAGTGTACGGGC. Inner Right Sequence: TGGAAACCGATGCCATTATT. Inner Primer PCR Length: 2119. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K01G5.2a. Homozygous. Outer Left Sequence: TTCTATGCTCATCGTTCCCC. Outer Right Sequence: CAGTCGGTGAGTTTGGGAAT. Inner Left Sequence: TTTTTACGGGCGAAATTCAG. Inner Right Sequence: TTCTGAGAATGCGTATTGCG. Inner Primer WT PCR product: 2399. Deletion size: 1739 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K01G5.2a. Homozygous. Outer Left Sequence: TTCTATGCTCATCGTTCCCC. Outer Right Sequence: CAGTCGGTGAGTTTGGGAAT. Inner Left Sequence: TTTTTACGGGCGAAATTCAG. Inner Right Sequence: TTCTGAGAATGCGTATTGCG. Inner Primer WT PCR product: 2399. Deletion size: 779 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Cosmid coordinates (with respect to T23G5): 24967-26802 (or 24965-26800, or 24966-26801, or 24968-26803, or 24969-26804 - note that each deletion endpoint lies within a TATA sequence so there is some ambiguity in the precise endpoints). Flanking sequences: CTATTCGGATATCTTGCCAATGCTA//TAGGAATTATTTTTGCGCTCTCAGG. Deletion size: 1836 bp.

zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10683 [T23G5.6::H1-wCherry + unc-119(+)].

stIs11640 [T08G5.7::H1-wCherry + unc-119(+)].

denEx26 [F08G5.6::GFP + pha-1(+)]. Maintain at >22 degrees. Reference: Alper S, et al. (2007) Mol Cell Biol 27:5544-53.

Heterozygotes are WT and segregate WT and dead eggs. 1/3 of the WT are rad-51(lg8701) homozygotes and will give only dead eggs.

T20G5.12. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T08G5.10. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T05G5.3. Homozygous sterile deletion chromosome balanced by bli-4-, let-?- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1882 homozygotes (sterile Unc with withered tail). Homozygous hT2[bli-4 let-? qIs48] normally inviable; occasional recombinants are seen (Bli, bright GFP). Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CACTAAGCAATGGTCTCGCA. External right primer: CGACAACAATGGAAACATCG. Internal left primer: CGCTTACGCCTTTTCTATCG. Internal right primer: ACCATTCTCTCGTGAATCCG. Internal WT amplicon: 2136 bp. Deletion size: 764 bp. Deletion left flank: TCGACAACAATGGAGCAATCAAGCTTGCCG. Deletion right flank: CGATAAATAAATTCGCTCTACTTTCATGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C03G5.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1908 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AACGAAGGCAAACTGGTGAC. External right primer: CTACGAGCGGTTCATTTGGT. Internal left primer: AATAGGAGCGGACCTTTGGT. Internal right primer: GCAATTCCGCACGTTTATCT. Internal WT amplicon: 2954 bp. Deletion size: 1211 bp. Deletion left flank: GACGAAGCTCGGCAGTTGAGATGTCTCCCT. Deletion right flank: GCATTACAATTAAAATATTCTGATTAAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T22G5.5. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk662 homozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGTTCTCCGTCTCGTCATTG. External right primer: ATTGAGTTCGTGGCAAATCC. Internal left primer: CTTGGTGTCCCTTTCGTGTT. Internal right primer: GTGTGCAACGTGGTTACCTG. Internal WT amplicon: 1706 bp. Deletion size: 1080 bp. Deletion left flank: TGGGTGTCTTCTCTCTAAATACAATTGATT. Deletion right flank: ATCTCGGCTTCTCGCATCGATCTGGAGTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K07G5.2, K07G5.3. External left primer: AATTTTCAGGCGAAGAAGCA. External right primer: TTCCACGTGTTCTTTCCACA. Internal left primer: GGTTTGATGGACAGTTGGCT. Internal right primer: ACCTTCAGACGTTTGCGACT. Internal WT amplicon: 1659 bp. Deletion size: 560 bp. Deletion left flank: CGTGGAAGAGGACACATGGAGAAGAACATG. Deletion right flank: AAGAACATTTGATGAAATTTAAAGCAAAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T23G5.3. Superficially wild type. External left primer: TCTTGTGCAAGTTCGAAACG. External right primer: AATTGAAAAGGGTGTGCGTC. Internal left primer: GTACATCTTCCTTTCGCCCA. Internal right primer: TAACCTTCCCCAAGATTCCC. Internal WT amplicon: 2170 bp. Deletion size: 683 bp. Deletion left flank: TTAATTTTATAATTCTATAGATATTCTACT. Deletion right flank: TCAAATTTTCCCAATCTACCGTAACCCCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K06G5.2. External left primer: TCACCCACGGACATGTAAGA. External right primer: TTTGGGCAGGTACAAACACA. Internal left primer: CTGATTGCGAGGAACAACAA. Internal right primer: GTGAACAGCGGTCTCACAAA. Internal WT amplicon: 1832 bp. Deletion size: 1291 bp. Deletion left flank: TTTGATGCCCTTTCAATGAGAAAACACCTT. Deletion right flank: AGTACAAGTAATTTCAGGTACTATCAGGAA. Insertion Sequence: AGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T21G5.3. Temperature-sensitive sterile. Gives some sterile progeny at 15 degrees. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T02G5.13. Homozygous viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2514 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGATTGGTGCACTGGTCATT. External right primer: AATCACGATACCTTGGACGC. Internal left primer: TCGTTTCGAAATTCGTCCTC. Internal right primer: ATGCCTGGTGACGACTACCT. Internal WT amplicon: 2798 bp. Deletion size: 1179 bp. Deletion left flank: TTTAAGAACAAAAACGTACCAAATGTGCTA. Deletion right flank: ATAGAAATAAGAGATATCAAGTGTTGAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18G5.4. External left primer: TATTCCATGATGGCGTCGTA. External right primer: CATGGTTGAGTGCAATGGTC. Internal left primer: TCAGGATCTGATGAATCCCC. Internal right primer: GCAGCGCTATCCGAGAATAC. Internal WT amplicon: 2935 bp. Deletion size: 2383 bp. Deletion left flank: ACTTGTAAAAATATGAAACGTATTTCAAAA. Deletion right flank: GCTATTTTTTAATCAGTCGCCTTCATTACA. Insertion Sequence: GGTGGTACTGACCAGAATTGCAGATCTACCAACGAGGCTATACGAATTGCAGGATTTGA TAACTTTGCTGATCAGCTCCAAGAATCCAATGGCGTTTTCGAAGCATGCCCAGAGGCCC ATTCAGAACAAGGAAATGAGAGTGAAGATTTTAAAGATTTGATCAATAGTGAAACTGAG TGCAACATTGAAGACGTTGTTCTCCCGACAGTACACGTTTCTACGGATTCTGAAGAAAT CATTTCGGGCGATGTGATTATGAATGGTTAGTAGATTGTTTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26G5.9. External left primer: TATCTCTTCCCAATCGGCAC. External right primer: CGAGTTCATGCTCAGCACAT. Internal left primer: TGTTTGCGAGAGAACCTTGA. Internal right primer: GTCTACTCGGAAGCTGGTGG. Internal WT amplicon: 1314 bp. Deletion size: 339 bp. Deletion left flank: GTTCATGTTCGGTTGCTGCATTCGTTGATG. Deletion right flank: ATGATTGAGCGCGCCTCGTAAATTTCTGGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T08G5.7. External left primer: CATCGCCTCAATCAGTCAAA. External right primer: TGTTGCCCCCTAATTTGTTG. Internal left primer: TTTCTTGCCTCCCTCTTGAA. Internal right primer: CAGTTTCCGTTTCGAAGCTC. Internal WT amplicon: 1279 bp. Deletion size: 581 bp. Deletion left flank: CAATCGTGTCACCTTATCATTCACATTTCT. Deletion right flank: GGCTGAAGTTGATCAATTCCGAATTCAGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T08G5.7. External left primer: CATCGCCTCAATCAGTCAAA. External right primer: TGTTGCCCCCTAATTTGTTG. Internal left primer: TTTCTTGCCTCCCTCTTGAA. Internal right primer: CAGTTTCCGTTTCGAAGCTC. Internal WT amplicon: 1279 bp. Deletion size: 646 bp. Deletion left flank: TATTGAAAAATCCCGATTTTCGTAGAATTT. Deletion right flank: CCAGGAGGAAGGTACAAATGCCCTGTGGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T20G5. External left primer: ATCAACCGGAGAACACGAAC. External right primer: AACCTGTTTGAATCGAACGC. Internal left primer: GCAAATGCACTAGATGCGAA. Internal right primer: GATTGGACGTGATGGAGGTT. Internal WT amplicon: 1084 bp. Deletion size: 306 bp. Deletion left flank: AAACCTTCATATCTTCCATTACTAATAGGT. Deletion right flank: TTCGTTCCGCTCTTTTCCGAAAGGGATTTC. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T05G5.8. External left primer: AGAGCAGCATCACAAGTGGA. External right primer: CTGGAAAAGGGGGACAAAAT. Internal left primer: CAACATCCTGAACTAAAACCTGG. Internal right primer: TATGTGTAGAGTGGCGGCTG. Internal WT amplicon: 1123 bp. Deletion size: 373 bp. Deletion left flank: CCAGGAACTCATTTAAAGTTTTCTCTTGAG. Deletion right flank: TTGCTGTTCGATGAACCATTTTACAAAGTT. Insertion Sequence: TATTTATAAATACATCCAAGAAAGTATCAAAAACACTCCAAATAGCTTTTTCGAATGAA A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C52G5. Identified by PCR, validated by CGH. External left primer: TCTTGGCTTTCTGACGTGTG. External right primer: CGTCGTTGGCAAAGGTAAAT. Internal left primer: GTTGAGTGAGCAATGACGGA. Internal right primer: TGCGAAATTTACGCCATACA. Internal WT amplicon: 2398 bp. Deletion size: 977 bp. Deletion left flank: CAGGAACGATTTGCAAACTTCCTGTATAAT. Deletion right flank: GAAAATATCACTAGATATTCTCTTATTCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K01G5.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2795 homozygotes (early larval arrest, Dpy or Dpyish). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCAACTTCCATCCTCGAAC. External right primer: CCTCCTCCTCTTCCTCGTCT. Internal left primer: CGCACCAATCACTACACACC. Internal right primer: GGCGTCTCCTCTTTCTTGAC. Internal WT amplicon: 1149 bp. Deletion size: 997 bp. Deletion left flank: GGGAGTATCACCATTAAAGCGTGACATCAA. Deletion right flank: ATTCGGAAAACCAAATGACACTACTCCAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T20G5.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2369 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCAAGACTCCGTCAATTCGT. External right primer: CGATTGGCTGCGATACTTTT. Internal left primer: CGTTTACAGCAACCACCTGA. Internal right primer: GTCTTTTGCGGAAATTCCAA. Internal WT amplicon: 3239 bp. Deletion size: 1382 bp. Deletion left flank: AAATAAAATGTGCGATTTCGCAATACCCAT. Deletion right flank: TGTTGTTCGTGAGATGGTAGGTCAAATAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T05G5.3. Homozygous sterile deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1881 homozygotes (sterile Unc). Pick WT and check for correct segregation of progeny to maintain. External left primer: CACTAAGCAATGGTCTCGCA. External right primer: CGACAACAATGGAAACATCG. Internal left primer: CGCTTACGCCTTTTCTATCG. Internal right primer: ACCATTCTCTCGTGAATCCG. Internal WT amplicon: 2136 bp. Deletion size: 1140 bp. Deletion left flank: AATCGGCGAAGGAACATACGGAGTCGTCTA. Deletion right flank: TCGTCTTCCGTGTATTGTTTAACTATCACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T02G5.4. External left primer: AGTTCAATTCAGGAGGCGAA. External right primer: AACCATTCCACTTGAGCCAC. Internal left primer: GTTCCTTGGTCAAGTCTGCC. Internal right primer: GTCACAAAGGGCAGCAACTC. Internal WT amplicon: 1153 bp. Deletion size: 416 bp. Deletion left flank: GAAGATCAAGAAGATCAAGGAAGGCTCAGT. Deletion right flank: TAATCGGTGTTATCATAATGTTTTTATCAA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T21G5.5. Heterozygotes are WT and segregate WT, arrested szT1 aneuploid progeny, Lon-2 males, and homozygous ok483 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T08G5.5. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2442 homozygotes (sterile, eggs don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTTTGACATTGCACATTGGG. External right primer: CATACACGCCTTGCGAAGTA. Internal left primer: GGTAGTTTGAATCACCGCGT. Internal right primer: CTTGTTAGCCGGTGGAAGAG. Internal WT amplicon: 2794 bp. Deletion size: 1397 bp. Deletion left flank: CCACGACGGCTTTTCGATTTAAATTTCTAG. Deletion right flank: TTTCGAACAGAAAAGAATACCATTTCACCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F11A6.1, W04G5.6, T22H2.1, T22H2.6, F11A6.2, T22H2.5, T22H2.3, R107.4, T22H2.2, W04G5.5, W04G5.10, W04G5.1, W04G5.15, W04G5.9, W04G5.12, W04G5.13, W04G5.11, W04G5.8, W04G5.7, W04G5.14, F11A6.8, F11A6.11, F11A6.5, F11A6.9, F11A6.13, F11A6.4, F11A6.10, F11A6.14, F11A6.6, F11A6.7, F11A6.12, T22H2.4, T22H2.7. The gk1264 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: ATTCTCGCAACAAATCCGAC. External right primer: CAATCGTCATTACACACGGC. Internal left primer: GCTCCGGTTTAGGGAATTGT. Internal right primer: AGTAGCAGTTTGGAAGCGGA. Internal WT amplicon: 2692 bp. Deletion size: 722 bp. Deletion left flank: TGAAGGTTCATGGAAAAAGCTGCGTAGAAG. Deletion right flank: TGCATTTGATGAAAGTCCTCTGTGATTCTT. The gkDf24 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T20G5.10. External left primer: TTGTGAAGGAGATTGCAACG. External right primer: GGAAGCTCAGTTGAGGGTTG. Internal left primer: TCTGTTTCATTTCATGTGCGA. Internal right primer: TTATCTCCGATTGGGTCTCG. Internal WT amplicon: 1347 bp. Deletion size: 645 bp. Deletion left flank: TTCTACCTCTCTGTTTCATTTCATGTGCGA. Deletion right flank: CGAGACCCAATCGGAGATAATAGTAAAACC. Insertion Sequence: TTTTCTATTTAACAACAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T20G5.6. Unc. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807