K01G5.6. Homozygous viable or sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk318 homozygotes (often sterile, lays eggs that don't hatch; some eggs hatch and develop to fertile adulthood). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R04B5.5. External left primer: CTGGAAAACTTGATCTATCGGG. External right primer: CCATTGACTGACTTTTTCTCCC. Internal left primer: AGAAGAGATAAGCGCACGGA. Internal right primer: CATGTTTCCTCTCGGCATTT. Internal WT amplicon: 1679 bp. Deletion size: 247 bp. Deletion left flank: ATTCCAAAGCCTGGGCCAAATCAGGTGCTT. Deletion right flank: TGTGAGCACTGCAAAACTGGAAGATACAAT. Validation: gk3180 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3181) in F38E9.5, detectable by PCR using the following primers. External left primer: GAGCAGCCAAAGGCTCATAC. External right primer: GGCTAGTCTCGGACTGGTTG. Internal left primer: GTGCTTCATTCTGTTCCGGT. Internal right primer: TTCCAATGATTCGAGGGTTC. Internal WT amplicon: 1591 bp. Deletion size: approximately 500 bp. Validation: gk3181 passed by CGH. Deleted probe: GAAGAAAGCATTTAGAAGTTATAGCTTTGGACTAGCATCCGTTTTAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F12F6.5. External left primer: GAAGTCACTTGAAGCATCAGAAAA. External right primer: TCAGAATCAAGCTTCTTTGTTGAG. Internal left primer: TCAAAAACCAATTTCGTTAGAGC. Internal right primer: TGATTTTTATTGCCTTTTTCCAA. Internal WT amplicon: 2179 bp. Deletion size: 470 bp. Deletion left flank: AATGGAAACCTCATGGAAAGACTCGAAGCA. Deletion right flank: TATTCCCAATATTCATGTTCGAACAGTTTT. Insertion Sequence: CTCGATATTCTCTTCGTAATCAGGGATTATTCCGAGTTTCTGGTTCACAATCGGAAATT AATCGATTCAGAGAAGCTTATGAAAGAGGAGAGGATCTATTCCAGTATCTGGGAGGATC TATTCCAGTATCTATTCCAG. Validation: gk3182 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3183) in F59E12.3, detectable by PCR using the following primers. External left primer: GCATGCAAGAAATGCAAGAA. External right primer: TGAAGTCGCGCACAAATAAG. Internal left primer: TCACAAATGGAAACGTGTGG. Internal right primer: CAACGAGGCCAAAGTGATTT. Internal WT amplicon: 1320 bp. Deletion size: 585 bp. Deletion left flank: GAACTGACAACAAGTATCTCAACCTACACG. Deletion right flank: CCCCCGTTTATGCGCCCAGGGCATCCCACA. Validation: gk3183 passed by CGH. Other deletions (gkDf32, gkDf35, gk3249, gk3250, gk3251) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3184) in W08D2.8, detectable by PCR using the following primers. External left primer: TGAACCATTTCACTAGCCCC. External right primer: GCTCTATCCGTTCTTCGTGC. Internal left primer: AATGATGTTCGGAAAGGCTG. Internal right primer: CATTCGGGAGTAGATGCGAT. Internal WT amplicon: 2184 bp. Deletion size: 652 bp. Deletion left flank: ATTCTCCAAAGGATTATTCAATGAGAAAAC. Deletion right flank: CTAAGTGAACTCATGTAATCAACAAAATAG. Validation: gk3184 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3185) in F42A10.3, detectable by PCR using the following primers. External left primer: ATCAAATCTGGTGCCATTCAG. External right primer: AAACAAACATGTGAAAAGCGG. Internal left primer: GGGAAGTGAACACTGATTGTGA. Internal right primer: TTTCTAGAACTTTCGATCCCGA. Internal WT amplicon: 1235 bp. Deletion size: 839 bp. Deletion left flank: GGGAAGTGAACACTGATTGTGAAGAGATAT. Deletion right flank: GTCTGATGTTTATACTCTCTCCCTTGGATT. Insertion Sequence: TTGAAGA. Validation: gk3185 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3186) in Y41D4A.5, detectable by PCR using the following primers. External left primer: TTTTTATCAGGTGGAAAATGGG. External right primer: GTTATTCGTGTGTTGCCTTGAA. Internal left primer: CGGAGAAAAATTGTGTGGAAA. Internal right primer: TTTCTTCATTTCTCAGCCGAA. Internal WT amplicon: 784 bp. Deletion size: 232 bp. Deletion left flank: AATTCGTGTTTTTTAGCCTAAATTTTCGCT. Deletion right flank: TCAAGTTTTTCAGTGAAAAATTTGAAAAAA. Validation: gk3186 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3187) in T05H4.13, detectable by PCR using the following primers. External left primer: AAGGACCTTCGAAACATAAGGAG. External right primer: ATCTCCACCCTCCCAATTAAATA. Internal left primer: AAGCAGGTGCTGACTGTGTG. Internal right primer: CATTCCAAATTTCGGCAGTT. Internal WT amplicon: 2323 bp. Deletion size: 512 bp. Deletion left flank: ACCACTGCTAGTCTCATTCAAAAGGCGTTT. Deletion right flank: GATCAAAAATGGAGGAAAAATCAACAAAAA. Validation: gk3187 passed by CGH. Other deletions (gk3201, gk3202, gk3203) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3188) in Y38H6C.3, detectable by PCR using the following primers. External left primer: ACGAAGACCGTTTTTGCAGT. External right primer: CCATCAAGATTACCCTCCGA. Internal left primer: TGTCGGCCGATGTAGATAAA. Internal right primer: CTCCGAGTGTCGAGGAGAAG. Internal WT amplicon: 978 bp. Deletion size: 286 bp. Deletion left flank: ACATAGCGCTTGGGCCAAGAAGTACTAGGA. Deletion right flank: AAATTATATGTTTCTCAAAAAAAAACTCAC. Insertion Sequence: G. Validation: gk3188 validated by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3189) in F23H12.6, detectable by PCR using the following primers. External left primer: CATCCTTTCCTGCACCTCAT. External right primer: CGCCGTACAATTGTGTTGAC. Internal left primer: CTTACCCAGACCTGCCAGAA. Internal right primer: TTGAAGGAATGTCGGGAGTT. Internal WT amplicon: 1579 bp. Deletion size: 530 bp. Deletion left flank: TATTTTAACTTGCCATCTGTCATTTATATA. Deletion right flank: CGACCTTTTATTATTGATTGAAGCATTCCA. Validation: gk3189 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807