More Fields
Strain Species Genotype
VH7075 C. elegans W04G5.10(hd7075[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1364 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGATTTCGAATCAAATCTTATTTTTTCTTC; Right flanking sequence: TCGTCAAAATGCGTCTCCAAATGTATAAAA. sgRNA #1: TTCTTCTTCGAAACACTCGG; sgRNA #2: ACTCGAGCAATTCAGACTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.