Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
MT16309 C. elegans mir-247&mir-797(n4505) X. Show Description
Deletion breakpoints are: CCAGTGTTACCACCGCTTGCTACAAACGGC / AAAAAATTTGAA...CAAAAATTTAT / CACATGAAATTATACCAAACAGTCAAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT17431 C. elegans nDf49 II; nDf59 V; mir-247(n4505) X. Show Description
mir-44, mir-61, and mir-247 are members of the mir-44 family. mir-45 is also part of this family, but is not deleted in thsi strain; it is closely linked to mir-44. Reference: Curr Bio (2010) 20:367-73.
MT17676 C. elegans mir-45(n4280) II; nDf59 V; mir-247(n4505) X. Show Description
nDf59 removes mir-61 and mir-250. mir-6, mir-247, and mir-45 are related in sequence. Reference: Curr Bio (2010) 20:367-73.
MT17848 C. elegans mir-2(n4108) I; nDf49 II; nDf59 V; mir-247(n4505) X. Show Description
mir-2 family and most of mir-44 family are removed in this strain (mir-45 is present). Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.