Search Strains

More Fields
Strain Species Genotype Add
DM7393 C. elegans pha-1(e2123) III; raEx393. Show Description
raEx393 [T05G5.1p::ZK643.1(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7396 C. elegans pha-1(e2123) III; raEx396. Show Description
raEx396 [T05G5.1p::ZK1098.1(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7397 C. elegans pha-1(e2123) III; raEx397. Show Description
raEx397 [T05G5.1p::C48D5.2(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7398 C. elegans pha-1(e2123) III; raEx398. Show Description
raEx398 [T05G5.1p::K08E3.5(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7399 C. elegans pha-1(e2123) III; raEx399. Show Description
raEx399 [T05G5.1p::Y53G8AR.8(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7414 C. elegans pha-1(e2123) III; raEx414. Show Description
raEx414 [T05G5.1p::pat-6(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7418 C. elegans pha-1(e2123) III; raEx418. Show Description
raEx418 [T05G5.1p::F36F2.1(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7420 C. elegans pha-1(e2123) III; raEx420. Show Description
raEx420 [T05G5.1p::W01A11.2(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7421 C. elegans pha-1(e2123) III; raEx421. Show Description
raEx421 [T05G5.1p::ZK1127.10(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7427 C. elegans pha-1(e2123) III; raEx427. Show Description
raEx427 [T05G5.1p::T15B12.1(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7430 C. elegans pha-1(e2123) III; raEx430. Show Description
raEx430 [T05G5.1p::F22F7.7(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7431 C. elegans pha-1(e2123) III; raEx431. Show Description
raEx431 [T05G5.1p::ZK1128.5(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DQM104 C. elegans bmdSi15 I. Show Description
bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Somatic expression of sfGFP(1-10) driven by the eft-3 promoter. CRISPR/Cas9-mediated recombination was used to insert eef-1a.1p::GFP into the standard MosSCI insertion site ttTi4348. Reference: Reference: Costa DS, et al. Development. 2023 May 1;150(9):dev201570. doi: 10.1242/dev.201570. PMID: 37039075.
DQM1051 C. elegans lin-12(ljf31[lin-12::mNeonGreen[C1]::loxP::3xFLAG]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Show Description
Endogenously-tagger reporters allow simultaneous visualization of endogenous LIN-12 localization and lag-2 expression levels. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.
DQM1066 C. elegans cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd204[lag-2::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs128 [rpl-28p::TIR1::T2A::mCherry::HIS-11)] II. Endogenously tagged LIN-12::mNG::3xFlag::AID* crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1 with nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.
DQM1068 C. elegans cshIs140 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd204[lag-2::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Endogenously tagged LIN-12::mNG::3xFlag::AID* crossed to endogenously tagged LAG-2::mTurquoise2::2xHA and ubiquitously expressed TIR1(F79G) with a nuclear mCherry marker. Reference: Medwig-Kinney TN, et al. An in vivo toolkit to visualize endogenous LAG-2/Delta and LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000602. doi: 10.17912/micropub.biology.000602. PMID: 35966395.
DQM1070 C. elegans cshIs128 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::LoxP::3xFLAG::AID*]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs128 [rpl-28p::TIR1::T2A::mCherry::his-11)] II. Auxin-dependent degradation of endogenous LIN-12 with visible readout of endogenous lag-2 expression. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.
DQM1072 C. elegans cshIs140 II; lin-12(ljf33[lin-12::mNeonGreen[C1]::loxP::3xFLAG::AID*]) III; lag-2(bmd202[lag-2::P2A::H2B::mTurquoise2::lox511i::2xHA]) V. Show Description
cshIs140 [rpl-28p::TIR1(F79G)::T2A::mCherry::HIS-11] II. Allows for conditional degradation of endogenous LIN-12 using 5-Ph-IAA. Reference: Pani AM, et al. A new toolkit to visualize and perturb endogenous LIN-12/Notch signaling in C. elegans. MicroPubl Biol. 2022 Jul 28;2022:10.17912/micropub.biology.000603. doi: 10.17912/micropub.biology.000603. PMID: 35966394.
DQM594 C. elegans bmdSi170 I. Show Description
bmdSi170 [loxN::eft-3p::his-58::GFP::3xHA] I. Superficially wild-type. bmdSi170 is a single-copy CRISPR/Cas9-engineered insertion of HIS-58 C-terminally tagged with non-codon-optimized GFP and driven by the ubiquitous eft-3 promoter. Reference: Azmi MA, et al. bioRxiv 2020.10.17.344069; doi: https://doi.org/10.1101/2020.10.17.344069
DR1099 C. elegans ama-1(m118m526) IV. Show Description
More resistant to alpha-amanitin than ama-1(m118). Will grow in the presence of 0.5% triton-X 100 with 100 ug/ml amanitin whereas ama-1(m118) will not. DR1099 displays temperature-sensitive defects consistent with defective RNA Pol II function. Sterile at 25C (maternal effect sterile). Fertile at 20C, but produces few viable progeny (~80% eggs that do not hatch). Periodically check for Emb to prevent spontaneously suppressed animals from taking over a population. Reference: Rogalski TM, et al. Genetics. 1990 Dec;126(4):889-98.
DR680 C. elegans dpy-13(e184) ama-1(m118) IV. Show Description
Dpy phenotype ranges from very tiny to normal dpy-13. Resistant to alpha-amanitin.
DR682 C. elegans dpy-13(e184) ama-1(m118m235) IV/nT1 [qIs51] (IV;V). Show Description
Temperature sensitive. Sensitive to alpha-amanitin. Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, dead embryos, and Dpy. Dpy progeny arrest in mid-larval stages at >20C. Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.
DR683 C. elegans dpy-13(e184) ama-1(m118m236)/nT1 IV; +/nT1 V. Show Description
Temperature sensitive . Sensitive to alpha-amanitin. Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, dead eggs and Dpys. Dpys are sterile adults at 15C and 20C. Dpys are early larval lethals at 25C.
DR684 C. elegans mDf9/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul and dead eggs. Homozygous Df is embryonic lethal. Strain is sensitive to alpha-amanitin. New stock received from Patrice Albert 12/95. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle.
DR685 C. elegans dpy-13(e184) ama-1(m118m238)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, Dpy and dead eggs. Dpys produce progeny at 15C and 20C, but are sterile at 25C. Strain is sensitive to alpha-amanitin.
DR697 C. elegans cha-1(m324) dpy-13(e184) ama-1(m118)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul and Lethals.
DR699 C. elegans dpy-13(e184) ama-1(m118m252)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are Dpy and segregate Dpy, Vul and dead eggs. Homozygous dpy-13 ama-1 animals are embryonic lethals. Strain is sensitive to alpha-amanitin.
DR730 C. elegans dpy-13(e184) ama-1(m118m238) IV. Show Description
Dpy. Sensitive to alpha-amanitin. Temperature sensitive, maintain at 15C. Fertile at 20C. Emb at restricitve temperature (25C). Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.
DR731 C. elegans dpy-13(e184) ama-1(m118m251) IV. Show Description
Dpy. Sensitive to alpha-amanitin. Temperature sensitive, maintain at 15C. Fertile at 20C. Emb at restrictive temperature (25C). Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.
DR811 C. elegans dpy-13(e184) ama-1(m118m332) IV/nT1 [qIs51] (IV;V). Show Description
Sensitive to alpha-amanitin. Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, dead embryos, and Dpy. Dpy progeny arrest in L1 stage at >20C. Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.
DR877 C. elegans dpy-13(e184) ama-1(m118m367) IV/nT1 [qIs51] (IV;V). Show Description
Sensitive to alpha-amanitin. Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, dead embryos, and Dpy. Dpy progeny arrest in L1 stage at >20C. Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.
DR880 C. elegans dpy-13(e184) ama-1(m118m370) IV/nT1 [qIs51] (IV;V). Show Description
Sensitive to alpha-amanitin. Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, dead embryos, and Dpy. Dpy progeny arrest in L1 stage at >20C. Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.
DR892 C. elegans dpy-13(e184) ama-1(m118m396) IV/nT1 [qIs51] (IV;V). Show Description
Temperature sensitive. Sensitive to alpha-amanitin. Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, dead embryos, and Dpy. Dpy progeny are maternal effect Emb at 20C and arrest in mid-larval stages at 25C. Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.
DR966 C. elegans dpy-13(e184) ama-1(+) IV. Show Description
Dpy. Sensitive to alpha-amanitin. [NOTE: formerly described as ama-1(m118m370m414), it has been determined that m414 was reversion of m367 back to wild-type sequence.] Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.
DR976 C. elegans dpy-13(e184) ama-1(m118m370m417) IV. Show Description
Dpy. Sensitive to alpha-amanitin. Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.
DV3208 C. elegans daf-15(re147[daf-15::mNG::2xHA]) IV. Show Description
mNeonGreen tag inserted at 3' end of endogenous daf-15 locus. Ubiquitous expression.
DV3765 C. elegans scd-1(re305[scd-1::mKate2::2xHA]) X. Show Description
mKate GLO (germline optimized) tag inserted at C-terminus of endogenous SCD-1. Red fluorescence in all nuclei. Cas9 guide + PAM: GACTTGGAAGAAGACGGTGG+AGG. Reference: Ailion M, et al. In preparation.
DWP294 C. elegans rhIs2. Show Description
rhIs2 [pat-3::HA::GFP]. rhIs2 contains cosmid-derived full-length pat-3, including 5 kb 5’UTR and 1 kb 3’ UTR, with HA and GFP(S65C) tags inserted prior to the pat-3 stop codon. Reference: Plenefisch JD, et al. Development. 2000 127(6):1197-207. doi: 10.1242/dev.127.6.1197.
ED3040 C. elegans C. elegans wild isolate. Show Description
Caenorhabditis elegans wild isolate. Isolated from compost from Jenny Pettifor's garden in the Paview neighborhood in Johannesburg, South Africa, on May 5, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): alpha. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
EG8829 C. elegans unc-119(ed3) oxTi872 III. Show Description
oxTi872 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:-1.41). Insertion into C23G10.7 3'UTR. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8830 C. elegans unc-119(ed3) III; oxTi873 IV. Show Description
oxTi873 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:6.44). Insertion into ZK896.1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8831 C. elegans unc-119(ed3) III; oxTi874 V. Show Description
oxTi874 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:-13.00). Insertion into srh-36. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8832 C. elegans unc-119(ed3) III; oxTi875 V. Show Description
oxTi875 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: High percentage of males observed (unpublished observations, Chee Kiang Ewe, Rothman lab, UCSB). NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:20.19). Insertion into pro-3 3'UTR. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8833 C. elegans unc-119(ed3) III; oxTi876 IV. Show Description
oxTi876 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:4.53). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8834 C. elegans oxTi877 II; unc-119(ed3) III Show Description
oxTi877 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:-2.02). Insertion into ggr-3. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8835 C. elegans unc-119(ed3) III; oxTi878 V. Show Description
oxTi878 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:1.58). Insertion into B0507.6. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8836 C. elegans unc-119(ed3) III; oxTi879 V. Show Description
oxTi879 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:2.02). Insertion into H24G06.1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8837 C. elegans unc-119(ed3) III; oxTi880 IV. Show Description
oxTi880 [vha-6p::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Cytoplasmic green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:1.82). Insertion into drp-1. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1401 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8838 C. elegans oxTi882 II; unc-119(ed3) III. Show Description
oxTi882 [vha-6p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:0.13). Insertion into ncRNA C44B7.21. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1405 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.
EG8839 C. elegans unc-119(ed3) III; oxTi884 IV. Show Description
oxTi884 [vha-6p::GFP::2xNLS::tbb-2 3'UTR + Cbr-unc-119(+)] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence in intestinal cells visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:3.90). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1405 into unc-119(ed3)(11x outcrosss) with Cbr-unc-119(+) selection.