Search Strains

Break points: In(Y102A11A.6 R09F10.1 In(lon-2 mec-10)) X. Covered region (Mb) 6.4 (2..8.5) Lon Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(Y102A11A.6 R09F10.1 In(lon-2 mec-10)) X. Covered region (Mb) 6.4 (2..8.5) Balancer marked with myo-2p::mCherry. Lon Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Unc Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Balancer marked with myo-2p::Venus. Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

tmIs1240 [myo-2p::Venus, X: F23D12.4] X. tmEx4950 [unc-9(+) + vha-6p::GFP]. Pick non-Unc with bright GFP+ in gut to maintain array. Balancer marked with myo-2p::Venus. Mec (Unc). Balancer break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Males carrying the array (intestinal GFP) can mate. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

tmIs1233 [myo-2p::mCherry, X: F23D12.4] X. tmEx4950 [unc-9(+) + vha-6p::GFP]. Pick non-Unc with bright GFP+ in gut to maintain array. Balancer marked with myo-2p::mCherry. Mec (Unc). Balancer break points: In(mec-10 Y7A5A.20 In(odr-7 F59F4.2)) X. Covered region (Mb) 7.4 (8.5..15.8) Males carrying the array (intestinal GFP) can mate. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Heterozygotes segregate wild-type heterozygotes, Dpy, and sec-5 homozygotes (scrawny, small broods, abnormal gut appearance) sec-5 is homozygous maternal-effect lethal; M+Z- animals produce a few dead L1-L2 stage larvae with Vab defects. Based upon phenotype, pk2357 is a strong loss-of-function, but likely not a null allele; molecular lesion produces a premature stop at position 389. Reference: Frische EW, et al. EMBO J. 2007 Dec 12;26(24):5083-92. [NOTE: This strain was previously described as carrying pk2358, but pk2357 is the correct allele. Both pk2357 and pk2358 cause the same nonsense (amber) change.]

Heterozygotes are WT with GFP+ (pharynx) and segregate Dpy with GFP+ (pharynx) and slow growing GFP- animals which are generally sterile (with germline tumor at 25C). pro-1(na48) is a weak, recessive, loss-of-function allele that behaves as a stronger loss-of-function at lower temperatures. At 25C, 85% of na48 animals will develop a proximal germline tumorr. Although tumors are less common at lower temperatures, the animals are generally sterile due to low proliferation and somatic gonad defects. na48 animals are slow growing at all temperatures.

Heterozygotes are WT and segregate WT, Dpys which produce dead eggs, and DpyUncs.

Maternal effect temperature sensitive embryonic lethal. Leaky. Maintain at 15C. mett-10 was formerly known as let-42.

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of HIS-72 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous his-72 locus. Genetic background: strain CF4582. Insertion verified by PCR and fluorescence. Left flank: 5' CTCGCCAGACGCATTCGCGGAGAACGTGCT 3' (one silent mutation); Right flank: 5' TAAgctccatcaccaattctcgaagcactt 3'; sgRNA: GAGCTTAAGCACGTTCTCCG; Cas9/sgRNA plasmid: pGLOW87; wrmScarlet11^SEC^3xMyc plasmid: pGLOW88; SEC insertion allele strain: GLW26

muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of EGL-1 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous egl-1 locus. Genetic background: strain CF4582. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' CAGAAGTCTCTTCCATCGTCTTCTGGACTTTTTCGCTTTT 3' (one silent mutation); Right flank: 5' TAAgtgatcaaaatctccaacttttctcca 3'; sgRNA: AGTCCAGAAGACGATGGAAG; Cas9/sgRNA plasmid: pGLOW65; wrmScarlet11^SEC^3xMyc plasmid: pGLOW66; SEC insertion allele strain: GLW28.

Heterozygotes are WT and segregate WT and DpyUnc. age-1(mg44) homozygotes from heterozygous mothers are WT and segregate only dauers at all temperatures. mg44 pka daf-23(mg44).

age-1(mg44) homozygotes throw all dauers at all temperatures (maternal effect dauer constitutive); can be rescued zygotically. age-1(mg44) homozygous animals that are maternally rescued for dauer formation are long-lived. mg44 is a Trp405 Amber mutation. Heterozygotes are WT and segregate WT (1/3 of which throw only dauers) and DpyUncs.

RNAi-defective. Reference: Zhang C, et al. Curr Biol. 2012 May 22;22(10):881-90.

CRISPR/Cas9 used to engineer a 6bp in-frame deletion in 5' coding region removing 2 amino acid residues that are conserved from yeast to human that might be critical for U1A binding to U1 snRNA Reference: Newman MA, et al. Genes Dev. 2018 May 1;32(9-10):670-681. PMID: 29739806

Pick non-Uncs to maintain. arDp2 is derived from mnC1, hence carries dpy-10(e128) and possibly unc-52(e444). arDp2 is a free duplication but does not pass at a high frequency. arDp2 is not stable as a balancer. It is prone to recombination; pick non-Unc and check for segregation of unc-4 and WT in progeny. Do not distribute this strain; other labs should request it from the CGC.

arIs37 [myo-3p::ssGFP + dpy-20(+)] I. Coelomocyte endocytosis defect. GFP accumulates in body cavity. MTM-9=Y39H10A.3 mtm-9 pka cup-10. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, Uncs and Sterile Dpys which have an everted vulva. ar95 previously called evl-10(ar95). See also WBPaper00004382. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, Steriles with and Everted Vul and DpyUncs. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, DpyUncs and Steriles which have an everted vulva. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, Steriles with and Everted Vul and DpyUncs. See also WBPaper00005256. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, DpyUncs and Steriles which have an everted vulva. Segregates males, so may have a him- mutation? ar104 previously called evl-22 and mat-2. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, Steriles with an Everted Vul and DpyUncs. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, DpyUncs and Steriles which have an everted Vulva. CGC rec'd new stock from Iva Greenwald 5/2000. The unc-85 dpy-10 chromosome had been lost from this stock; for some reason it was difficult to maintain as a heterozygote. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, DpyUncs and Steriles which have an everted vulva. Throws males. Do not distribute this strain; other labs should request it from the CGC.

Heterozygotes are WT and segregate WT, DpyUncs and Steriles which have an everted vulva. Do not distribute this strain; other labs should request it from the CGC.

Long. Unc. At 15C ar41 suppresses the 2 AC (anchor cell) phenotype of n676n930. (Strain GS878 does not contain sel(arX) and therefore does not suppress the Egl phenotype at 25C.) See also WBPaper00002966. Do not distribute this strain; other labs should request it from the CGC.

rtIs31 [elt-2p::GFP + Posm-10::HtnQ150].

nuIs11 [osm-10::GFP + lin-15(+)]. Array contains pool28; KP#57-59 (osm-10::GFP insert at Nrul site) and pJM24 [lin-15(+) rescues n765 at 20C]. GFP expressed in ASH, ASI, PHA and PHB after 3-fold. nuIs11 may be inserted on LG I.

rtIs11 [osm-10p::GFP + osm-10p::HtnQ150 + dpy-20(+)]. osm-10 promoter drives expression of both GFP and Htn-Q150 strongly in ASH and more weakly in other neurons of the head and tail. pqe-1(rt13) accelerates Htn-Q150 induced toxicity resulting in ASH neuron cell death predominantly during larval stages. Hence, many adult animals will lack overt GFP expression in ASH neurons. rtEx377 in the original HA759 was selected against leaving only rtIs11 in the strain available at the CGC.

goeIs397 [hsp-16.2p::cnc-10::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. Over-expression of cnc-10::SL2::mKate2 after heat shock. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

Heterozygotes are WT and segregate WT, DpyUncs and Unc Steriles that are slightly Long. sb56 is a recessive zygotic suppressor of let-502(ca201) early larval lethality. Likely null of mel-11.

5-bp deletion. Superficially wild-type. Reference: https://www.micropublication.org/journals/biology/micropub-biology-000169/

2-bp deletion. Superficially wild-type. Reference: https://www.micropublication.org/journals/biology/micropub-biology-000169/

Heterozygotes are WT with pharyngeal GFP. Segregates WT GFP+, Dpy GFP+ (mIn1 homozygotes) and few GFP- dsh-2(or302) mig-5(tm2639) homozygotes (Sys). Pick WT GFP+ animals and check for correct segregation of progeny to maintain.

Heterozygotes are WT with pharyngeal GFP. Segregates WT GFP+, Dpy GFP+ (mIn1 homozygotes) and few GFP- dsh-2(or302) dsh-1(ok1445) homozygotes (Sys Unc). Pick WT GFP+ animals and check for correct segregation of progeny to maintain.

Heterozygotes are WT with pharyngeal GFP. Segregates WT GFP+, Dpy GFP+ (mIn1 homozygotes) and non-GFP triple homozygotes (mostly Emb with a few animals surviving to early L1). Pick WT GFP+ animals and check for correct segregation of progeny to maintain.

Heterozygotes are WT and GFP+. os37 homozygotes are Lvl and Psa. Pick GFP+ heterozygotes to maintain. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Reference: Shibata Y, et al. Dev Biol. 2012 Jan 15;361(2):349-57.

osEx89 [col-10::GFP + dpy-22(+)]. Animals with the array are non-Dpy and GFP+. Animals which have lost the array are Dpy, Egl, and GFP-.

osEx89 [col-10::GFP + dpy-22(+)]. Animals with the array are non-Dpy and GFP+. Animals which have lost the array are Dpy, Egl, and GFP-.

Heterozygotes are WT GFP+ and segregate WT GFP+, Dpy GFP+ (mIn1 homozygotes), and os33 homozygotes (GFP-, Dpy, Muv, Steriles).

Heterozygotes are WT and GFP+. mIn1 homozygotes are Dpy and GFP+. vab-1; sax-3 homozygotes are synthetic lethal.

kpIs100 [pie-1p::Ub(G76V)::GFP::H2B::drp-1 3' UTR + unc-119(+)]. [NOTE: (4/4/2025): Strain segregates Rol, and non-Rol, possibly due to a background dpy-10 mutation; both express GFP as expected. It was recommended that non-Rollers be picked when maintaining the strain.] Expresses Ubiquitin::GFP fusion protein in the germ line. The last amino acid of ubiquitin is mutated to valine (G76V), which prevents the cleavage of ubiquitin from GFP by the deubiqutinating enzymes and renders the GFP constitutively targeted for degradation by the proteasome. The strain can be used to assay proteasome activity in the germ line. Reference: Kumar GA & Subramaniam K. Development. 2018 Mar 29;145(7):dev163949. PMID: 29540500

Heterozygotes are wild type and segregate wild type heterozygotes, paralyzed DpyUncs, and Uncs with germline tumors. Pick WT and check segregation of progeny to maintain. Reference: Vaid S, et al. Development. 2013 Apr;140(8):1645-54.

Heterozygotes are WT and segregate WT, DpyUncs and unc-104(ut60) animals which are L1 lethal coilers.

bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3? UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3? UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Somatic expression of sfGFP(1-10) driven by the eft-3 promoter. GFP11 tag inserted into endogenous lmn-1 locus via CRISPR/Cas9 insertion into parental strain DQM104. Reference: Gregory EF, et al. MicroPubl Biol. 2023 Dec 13:2023:10.17912/micropub.biology.001022. doi: 10.17912/micropub.biology.001022. eCollection 2023. PMID: 38152058.

Modular linker::mNeonGreen::3xFLAG::linker tag inserted at the C-terminus of the endogenous mlt-10 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.

Modular linker::mNeonGreen::3xFLAG::linker tag inserted internally in exon 2 of the endogenous col-10 locus by CRISPR which will produce a translational fusion after amino acid 89. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs.

mwEx32 [pat-3(YYFF) + sur-5::GFP]. Pick GFP+ to maintain. mwEx32 carries a mutant form of pat-3 gene with tyrosine (Y) to phenylalanine (F) mutations; rescues pat-3 null allele. Abnormal DTC migration. Reference: Lee M, et al. J Biol Chem. 2001 Sep 28;276(39):36404-10.