K08F8.6. Unc. External left primer: TCAATGCCTGGAGATGATGA. External right primer: CCCGCCTTCTTTATCTGTTG. External WT amplicon: 434 bp. This strain carries a point mutation in K08F8.6. The mutation is gk908, which is a G->A mutation at K08F8 coordinate 36647 (flanking sequences AATGGTTGAAGAAAGCAAGAAGGAAAGTTA and CAAACAACAGATAAAGAAGGCGGGGCAGTA). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Heterozygotes are WT GFP+ and segregate WT GFP+, Dpy GFP+ (mIn1 homozygotes), and os33 homozygotes (GFP-, Dpy, Muv, Steriles).

F07H5.2, K08F8.6. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok331 homozygotes (grotty sterile Dpy with vulval blip). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGAAAATTGGGAGTTCGGAG. External right primer: ACCACTTGTTCCTTGCCAAC. Internal left primer: GGACTGGAAACTCCAAGCAG. Internal right primer: GACTGATGAGCCGGTATGGT. Internal WT amplicon: 2637 bp. Deletion size: 1456 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Hets are WT and segregate WT, paralysed DpyUnc, and early larval Unc-4. Maintain by picking WT.

osEx108 [(pAY105) let-19::GFP + rol-6(su1006)]. Rollers. Pick rollers to maintain. Reference: Yoda et al. Development (2005) vol. 132 (8) pp. 1885-93.