Search Strains

csEx52[hsp::lin-45AA + sur-5::GFP]. Maintain by picking GFP+.

csEx53[hsp::lin-45AA + sur-5::GFP]. Maintain by picking GFP+.

csEx63 [(pMS88) hsp16-41::torso^4021-Draf + (pTG96) sur-5::GFP]. Pick GFP+ to maintain. Muv phenotype in GFP+ after heat shock during larval stage. References: Kao G, et al. Development. 2004 Feb;131(4):755-65. Rocheleau CE, et al. Proc Natl Acad Sci U S A. 2005 Aug 16;102(33):11757-62.

csEx72[hsp::lin-45ED + sur-5::GFP]. Maintain by picking GFP+.

Most animals die as rod-like lethal L1 larvae. Grow at 20C.

cs207 is an early nonsense allele (Q72stop). Approximately 90% rod-like larval lethal, with 10% normal escapers. Exact percentages are sensitive to temperature and culture conditions.

lin-3(-) heterozygous balanced strain containing single copy MOS-mediated insertion of csSi1 transgene encoding lin-3S (short) splice isoform, expressed under control of the lin-3 promoter. The transgene rescues lethal and Vulvaless phenotypes (but not sterility) of lin-3 mutants, which can be recognized by absence of myo-2::GFP from the nT1 balancer. Pick GFP+ to maintain.

lin-3(-) heterozygous balanced strain containing single copy MOS-mediated insertion of csSi1 transgene encoding lin-3L (long) splice isoform, expressed under control of the lin-3 promoter. The transgene partially rescues lethal and Vulvaless phenotypes (but not sterility) of lin-3 mutants, which can be recognized by absence of myo-2::GFP from the nT1 balancer. Pick GFP+ to maintain.

csEx436 [lpr-3 (fosmid WRM619dE09) + myo-2p::mCherry]. Pick mCherry+ animals to maintain. cs231 is a Crispr/Cas9-induced null allele of lpr-3: a 13 nucleotide deletion in exon 1 results in frameshift. Homozygous mutants are embryonic lethal, but are rescued by csEx436 containing lpr-3(+) fosmid WRM619dE09. NOTE: lpr-3(cs231) should be considered the canonical allele as ok2351 also perturbs expression of adjacent gene lpr-6. Reference: Forman-Rubinsky R, Cohen JD and Sundaram MV. Genetics. 2017 Oct;207(2):625-642.

Endogenous lpr-3 locus tagged with ssSfGFP using CRISPR/Cas9. Superficially wild-type. Reference: Cohen JD, et al. Elife. 2020 Sep 25;9:e57874. PMID: 32975517.

Endogenous let-653 locus tagged with SfGFP using CRISPR/Cas9. Superficially wild-type. Reference: Cohen JD, et al. Elife. 2020 Sep 25;9:e57874. PMID: 32975517.

Endogenous let-4 locus tagged with mCherry using CRISPR/Cas9. mCherry expression is faint. Superficially wild-type. Reference: Cohen JD, et al. Elife. 2020 Sep 25;9:e57874. PMID: 32975517.

csEx919 [WRM069E05 + sur-5p::GFP]. Pick GFP+ to maintain. bli-4(cs281) is a null allele and causes embryonic lethality. csEx919 contains a bli-4(+) fosmid WRM069E05 and rescues bli-4 lethality. cs281 is a 1nt deletion causing a frameshift before the peptidase domain. GTGGGGAACCAATACATACC -> GT-GGGAACCAATACATACC. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.

Temperature sensitive missense allele. Larval lethal and Vul at 25C. About WT at 20C. Previously called let-341.

Weak hypomorphic allele. Cold-sensitive. Egl, Pvul and sterile at 20C.

Heterozygotes are WT and segregate WT, Uncs, and Pvul which are sterile.

qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Segregates WT glowing hets, non-glowing steriles (germ cells in oogenesis arrested in pachytene), very rare homozygous hT2 glowing animals, and dead eggs. Vulval development in ksr-2 animals appears normal. The molecular lesion of dx27 is a 285 base deletion. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.

sur-6(sv30) homozygotes are viable but segregate 100% dead embryos, and are GFP-. Weak Vulvaless and Unc. Maintain strain by picking GFP+ heterozygotes. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.

Him strain. Superficially wild-type. References: Portman and Emmons Dev Bio (2004) & Miller and Portman Mod & Mech (2010).

Him strain. Superficially wild-type. References: Portman and Emmons Dev Bio (2004) & Miller and Prtman Mod & Mech (2010).

Him strain. Superficially wild-type. Males have mating (response) defect but are fertile; otherwise superficially wild-type. Reference: Miller and Prtman Mod & Mech (2010).

Benzaldehyde/starvation learning defective. mm200 is a single base pair change resulting in an L199F substitution. Reference: Merritt DM, et al. A Novel Memory Type in C. elegans Exhibits Post-Training Consolidation. bioRxiv 2023.02.22.529281. doi: https://doi.org/10.1101/2023.02.22.529281.

Double mutant with loss of function in both CREB genes. Derived by crossing parental strains YT17 crh-1(tz2) and VC3149 crh-2(gk3293). Reference: Merritt DM, et al. A Novel Memory Type in C. elegans Exhibits Post-Training Consolidation. bioRxiv 2023.02.22.529281. doi: https://doi.org/10.1101/2023.02.22.529281.

utkIs1 [mbr-1p::GFP + rol-6(su1006)]. Culture under normal conditions. Reference: Curr Biol. 2005 Sep 6;15(17):1554-9.

utkEx6 [mbr-1p::GFP + rol-6(su1006)]. Rollers.

utkEx7 [mbr-1p::GFP + cwn-1p(1.4kb)::cwn-1 + rol-6(su1006)]. Rollers.

utkEx8 [mbr-1p::GFP + cwn-1p(0.7kb)::cwn-1 + rol-6(su1006)]. Rollers.

utkEx9 [mbr-1p::GFP + cwn-1p(170bp)::cwn-1 + rol-6(su1006)]. Rollers.

utkEx10 [mbr-1p::GFP + cwn-2p(4.0kb)::cwn-2 + rol-6(su1006)]. Rollers.

utkEx11 [mbr-1p::GFP + cwn-2p(2.1kb)::cwn-2 + rol-6(su1006)]. Rollers.

utkEx12 [mbr-1p::GFP + cwn-2p(0.8kb)::cwn-2 + rol-6(su1006)]. Rollers.

utkEx13 [mbr-1p::GFP + H20::cwn-1 + H20::cwn-2 + rol-6(su1006)]. Rollers.

utkEx14 [mbr-1p::GFP + cwn-1p(1.8kb)::cwn-1 + rol-6(su1006)]. Rollers.

Culture under normal conditions. Reference: Curr Biol. 2005 Sep 6;15(17):1554-9.

utkEx15 [mbr-1p::GFP + cwn-1p(5.8kb)::cwn-2 + rol-6(su1006)]. Rollers.

utkEx2 [mbr-1p::GFP + rol-6(su1006)]. Rollers.

utkEx3 [mbr-1p::GFP + rol-6(su1006)]. Rollers.

utkEx4 [mbr-1p::GFP + rol-6(su1006)]. Rollers.

narSi2 [mex-5p::GFP::mpk-1B + unc-119(+)] II. narEx29 [sur-5p::GFP::mpk-1A + myo-3p::RFP]. mpk-1(-) strain with germline MPK-1B rescued by single-copy insertion and somatic MPK-1A rescued by an extrachromosomal array. Pick RFP+ to maintain; narEx29 rescues mpk-1 so array should be stable. Transgene uses codon-optimized version of GFP. Reference: Robinson-Thiewes et al. Cell Reports, In Press.

Superficially wild-type. nar13 was derived by excision of UTR43(nar12) cassette by heat shock. Tagged endogenous PAR-4A & C: weak, ubiquitous fluorescence. Reference: Roy et al. microPublication Biology. https://www.micropublication.org/roy_2018_mngpar-4.html

narSi2 [mex-5p::GFP::mpk-1B + unc-119(+)] II. mpk-1(-) strain with germline-specific expression of GFP::MPK-1B. GFP::MPK-1B rescues fertility but the animals are still Vulvaless. Transgene uses codon-optimized version of GFP. Reference: Robinson-Thiewes et al. Cell Reports, In Press.

pqIs2 [alp-1::GFP]. Maintain by picking GFP+. GFP is inserted in-frame in exon 14: all four ALP-1 isoforms will be expressed but only ALP-1a will be tagged with GFP. References: McKeown et al. Dev Dyn. 2006 Feb;235(2):530-8 & Han & Beckerle Cell 2009 May; 20(9):2361-70.

Heterozygotes are WT and segregate WT and Uncs. 1/3 of the WT are zhp-3(jf61::unc-119+) homozygotes and these lay mostly dead eggs.

Reference: Tang L, et al. Mol Biol Cell. 2010 Mar 15;21(6):885-96.

Reference: Tang L, et al. Mol Biol Cell. 2010 Mar 15;21(6):885-96.