Caenorhabditis Genetics Center (CGC)

Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
UP1321 C. elegans lpr-1(cs73) I. Show Description
Most animals die as rod-like lethal L1 larvae. Grow at 20C.
UP2436 C. elegans lpr-1(cs207) I. Show Description
cs207 is an early nonsense allele (Q72stop). Approximately 90% rod-like larval lethal, with 10% normal escapers. Exact percentages are sensitive to temperature and culture conditions.
PS10645 C. elegans plpr-1(sy2212)/mIn1 [dpy-10(e128) mIs14] II. Show Description
CRISPR-engineered plpr-1 null mutant balanced by dpy-10 and GFP-marked inversion. Heterozygotes are wild-type with pharyngeal GFP signal. Homozygous non-balancer animals not seen, suggesting this mutant is homozygous-lethal. Maintain by picking wild-type GFP+. CRISPR/Cas9 engineered STOP-IN null mutant of plpr-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAACATCCCCTTTCAGGTGTTCTCGGCGAGCCAATA. Right flanking sequence: CGGAGGTGTGACCACAGTTCCCGCACCACGACCC. STOP-IN cassette: GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCTCGGCGAGCCAATACGG.Detect method: Ext primers-- (F)ATTCTGAAAGCCGTATGCCTC; (R)GCAATTCCGACGACGTGAAG; mutant has 275bp PCR amplicon, wild-type has 232bp PCR amplicon. Int primers-- (F)ATTCTGAAAGCCGTATGCCTC; (R)GCTTATCACTTAGTCACCTCTGCTC; mutant has 178bp PCR amplicon, wild-type doesn't have any amplicon. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. doi: 10.1534/g3.118.200662. PMID: 30224336.
UP3648 C elegans lpr-1(cs249[lpr-1::sfGFP::3xFLAG]) I. Show Description
sfGFP::3xFLAG tag inserted at C-terminus of endogenous lpr-1 locus using CRISPR/Cas9. 3x outcrossed with hT2[qIs48]/+ males; qIs48 was used as a visible marker to identify cross progeny. Reference: Belfi AC, et al. Development. 2026 Aug 15;153(16):dev205309. doi: 10.1242/dev.205309. PMID: 41294099.
UP3697 C elegans lpr-1(cs251[lpr-1::mCherry::3xFLAG]) I. Show Description
mCherry::3xFLAG tag tag inserted at C-terminus of endogenous lpr-1 locus using CRISPR/Cas9. Reference: Belfi AC, et al. Development. 2026 Aug 15;153(16):dev205309. doi: 10.1242/dev.205309. PMID: 41294099.