Search Strains

More Fields
Strain Species Genotype Add
PHX2307 C. elegans ceh-13(syb2307[ceh-13::mNG::AID*]) III. Show Description
mNeonGreen and AID* tags inserted into endogenous ceh-13 locus. No phenotypes have been observed. Reference: Smith JJ, et al. Cell Rep. 2024 Mar 26;43(3):113857. doi: 10.1016/j.celrep.2024.113857. PMID: 38421866.
PHX2361 C.elegans egl-5(syb2361[egl-5::mNG::3xFLAG::AID*]) III. Show Description
mNeonGreen::3xFLAG::AID* tags inserted into endogenous egl-5 locus. No phenotypes have been observed. Reference: Smith JJ, et al. Cell Rep. 2024 Mar 26;43(3):113857. doi: 10.1016/j.celrep.2024.113857. PMID: 38421866.
PHX2493 C elegans lgc-38(syb2346[flp-11p::dpy-10 site::flp-11UTR] syb2493[ReaChR::linker::mKate2]) III. Show Description
ReaChR expressed in RIS for optogenetic activation. Reference: Busack I & Bringmann H. PLOS Genetics 19(3): e1010665. https://doi.org/10.1371/journal.pgen.1010665.
PHX2616 C. elegans ins-9(syb2616[ins-9::T2A::3xNLS::GFP]) X. Show Description
Endogenous ins-9 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
PHX267 C. elegans ikb-1(syb267[ikb-1::mCherry]) I. Show Description
mCherry tag inserted into the endogenous ikb-1 locus. IKB-1::mCherry is observed in the pharynx and body wall muscles during development. No obvious phenotype. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.
PHX2685 C. elegans ins-6(syb2685[ins-6::T2A::3xNLS::GFP]) II. Show Description
Endogenous ins-6 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
PHX2704 C. elegans nlp-50(syb2704[nlp-50::T2A::3xNLS::GFP]) II. Show Description
Endogenous nlp-50 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
PHX3112 C. elegans nlp-12(syb3112[nlp-12::T2A::3×NLS::GFP]) I. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3169 C. elegans flp-12(syb3169[flp-12::T2A::3xNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3172 C. elegans flp-25(syb3172[flp-25::T2A::3×NLS::GFP]) III. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3179 C. elegans nlp-10(syb3179[nlp-10::T2A::3×NLS::GFP]) III. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3184 C. elegans flp-17(syb3184[flp-17::T2A::3xNLS::GFP]) IV. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3187 C. elegans flp-10(syb3187[flp-10::T2A::3xNLS::GFP]) IV. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3193 C. elegans flp-18(syb3193[flp-18::T2A::3×NLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3195 C elegans flp-33(syb3195[flp-33::T2A::3xNLS::GFP]) I. Show Description
GFP tag inserted into endogenous flp-33 locus using CRISPR/Cas9 engineering. GFP expression in ADE (in head). Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095.
PHX3207 C. elegans flp-28(syb3207[flp-28::T2A::3xNLS::GFP]) X. Show Description
Endogenous flp-28 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
PHX3222 C. elegans nlp-17(syb3222[nlp-17::T2A::3×NLS::GFP]) IV. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3229 C. elegans flp-9(syb3229[flp-9::T2A::3xNLS::GFP]) IV. Show Description
CRISPR/Cas9 engineered tagged endogenous locus.
PHX3230 C. elegans flp-15(syb3230[flp-15::T2A::3xNLS::GFP]) III. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3240 C. elegans nlp-1(syb3240[nlp-1::T2A::3XNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3242 C. elegans flp-23(syb3242[flp-23::T2A::3xNLS::GFP]) III. Show Description
CRISPR/Cas9 engineered tagged endogenous locus.
PHX3250 C. elegans capa-1(syb3250[capa-1::T2A::3xNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3251 C. elegans flp-16(syb3251[flp-16::T2A::3XNLS::GFP]) II. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3257 C. elegans flp-34(syb3257[flp-34::T2A::3xNLS::GFP]) V. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3262 C. elegans nlp-47(syb3262[nlp-47::T2A::3XNLS::GFP]) IV. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3278 C. elegans flp-19(syb3278 [flp-19::T2A::3xNLS::GFP]) X. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
PHX3288 C. elegans nlp-23(syb3288[nlp-23::T2A::3xNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3301 C. elegans flp-22(syb3301[flp-22::T2A::3xNLS::GFP]) I. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3317 C. elegans flp-11b(syb3317[flp-11b::T2A::3XNLS::GFP]) X Show Description
CRISPR/Cas9 engineered tagged endogenous locus.
PHX3319 C. elegans nlp-22(syb3319[nlp-22::T2A::3×NLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3320 C. elegans nlp-49(syb3320[nlp-49::T2A::3XNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
PHX3321 C. elegans ntc-1(syb3321[ntc-1::T2A::3xNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3323 C. elegans flp-14(syb3323[flp-14::T2A::3xNLS::GFP]) III. Show Description
Endogenous flp-14 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
PHX3334 C. elegans flp-24(syb3334[flp-24::T2A::3×NLS::GFP]) III. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3372 C. elegans rgba-1(syb3372[rgba-1::T2A::3xNLS::GFP]) I. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3373 C. elegans nlp-70(syb3373[nlp-70::T2A::3xNLS::GFP]) V. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3384 C. elegans nlp-64(syb3384[nlp-64::T2A::3xNLS::GFP]) X. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3388 C. elegans nlp-38(syb3388[nlp-38::T2A::3xNLS::GFP]) I. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3411 C. elegans nlp-13(syb3411[nlp-13::T2A::3xNLS::GFP]) V. Show Description
Endogenous nlp-13 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
PHX3436 C. elegans flp-4(syb3436[flp-4::T2A::3XNLS::GFP]) II. Show Description
Endogenous locus tagged with T2A::3xNLS::GFP using CRISPR/Cas9. Please contact Oliver Hobert prior to publishing work using this strain.
PHX3588 C. elegans flp-26(syb3588[flp-26::T2A::3xNLS::GFP]) X. Show Description
Endogenous flp-26 locus tagged with 3xNLS::GFP reporter. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.
PHX3634 C elegans pah-1(syb3634[GFP::H2B::T2A::pah-1]) II. Show Description
Superficially wild-type. GFP tag inserted into endogenous pah-1 locus by CRISPR/Cas9.
PHX3678 C elegans tph-1(mg280) pah-1(syb3678[GFP::H2B::T2A::pah-1]) II. Show Description
GFP tag inserted into endogenous pah-1 locus by CRISPR/Cas9.
PHX3691 C. elegans sqt-3(syb3691[sqt-3::mNG(int)]) V. Show Description
mNeonGreen tag inserted into endogenous sqt-3 locus between CFCS and collagen domains. GCCTACGGAGGACCAGAAGTCAACC -> GCCTACGGAGGA^CCAGAAGTCAACC. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.
PHX4257 C. elegans eat-4(syb4257[eat-4::T2A::GFP::H2B]) III. Show Description
Endogenous eat-4 locus tagged with T2A::GFP::H2B. Healthy strain that has all glutamatergic neurons marked with GFP. Reference: Vidal B, et al. Elife. 2022 Mar 24;11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425
PHX4374 C. elegans flp-32(syb4374[flp-32::SL2::gfp::H2B]) X. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. Proc Natl Acad Sci USA. 2022 Sep 13;119(37):e2206817119. doi: 10.1073/pnas.2206817119. PMID: 36067313.
PHX4421 C. elegans trh-1(syb4421[trh-1::SL2::GFP::H2B]) IV. Show Description
CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. Elife. 2022 Mar 24:11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425.
PHX4430 C. elegans kcc-3(syb4430[kcc-3::SL2::TagRFP-T::H2B]) II. Show Description
Endogenous locus tagged with SL2::TagRFP-T::H2B at C-terminus using CRISPR/Cas9. Reference: Aguilar GR, et al. PLoS Biol. 2025 Jan 6;23(1):e3002979. doi: 10.1371/journal.pbio.3002979. PMID: 39761329
PHX4447 C. elegans aex-2(syb4447 [aex-2::SL2::GFP::H2B)] X. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Reference: Cros C & Hobert O. Proc Natl Acad Sci USA. 2022 Sep 13;119(37):e2206817119. doi: 10.1073/pnas.2206817119. PMID: 36067313.
PHX4453 C. elegans trhr-1(syb4453[trhr-1::SL2::GFP::H2B]) I. Show Description
CRISPR/Cas9-engineered reporter allele. Reference: Vidal B, et al. Elife. 2022 Mar 24:11:e76003. doi: 10.7554/eLife.76003. PMID: 35324425.