| OW478 |
C elegans |
kmo-1(tm4529) V. Show Description
R07B7.5. Homozygous viable. Reference: van der Goot AT, et al. Proc. Natl. Acad. Sci. U.S.A. 2012 109(37) 14912-7.
|
|
| OW479 |
C elegans |
haao-1(tm4627) V. Show Description
K06A4.5. Homozygous viable. Reference: van der Goot AT, et al. Proc. Natl. Acad. Sci. U.S.A. 2012 109(37) 14912-7.
|
|
| OW715 |
C. elegans |
tdo-2(zg216) III. Show Description
Crispr/Cas9 engineered deletion mutant removes 28 basepairs in tdo-2 coding region. Reference: Michels H, et al. Sci Rep. 2016 Dec 20;6:39199.
|
|
| OW716 |
C elegans |
tdo-2(zg217) III. Show Description
Crispr/Cas9 engineered deletion mutant removes 14 basepairs in tdo-2 coding region. Reference: Michels H, et al. Sci Rep. 2016 Dec 20;6:39199.
|
|
| OW717 |
C elegans |
tdo-2(zg218) III. Show Description
Crispr/Cas9 engineered deletion mutant removes 9 basepairs in tdo-2 coding region. Reference: Michels H, et al. Sci Rep. 2016 Dec 20;6:39199.
|
|
| OX977 |
C. elegans |
unc-34(gm104) V. Show Description
Unc. According to Withee (2004), gm104 has been sequenced and introduces an early amber stop at W24. Reference: Withee J, et al. Genetics. 2004 Jul;167(3):1165-76. PMID: 15280232
|
|
| PB1 |
C. elegans |
him-5(e1490) V; unc-115(e2225) vab-3(bx23) X. Show Description
Unc-lethargic and kinker. Throws abnormal males-fused rays 4 and 6.
|
|
| PB101 |
C. briggsae |
Cbr-cby-3(bd101) X. Show Description
Chubby (short and fat--analogous to C. elegans Dpy phenotype). Parental strain is Caenorhabditis briggsae G16. Males are chubby, therefore cby-3 is X-linked.
|
|
| PB192 |
C. briggsae |
Cbr-him-8(v188) I; stIs20120 X. Show Description
stIs20120 [Cbr-myo-2p::GFP + Cbr-unc-119(+)] X. Him. Reference: Ragavapuram V, et al. G3 (Bethesda). 2015 Dec 31.
|
|
| PB2 |
C. elegans |
him-5(e1490) V; vab-3(bx23) egl-15(n484) X. Show Description
Type A Egl. Males abnormal-fused rays. See also WBPaper00002235.
|
|
| PB201 |
C. remanei |
Cre-unc(bd201). Show Description
Male-female strain. Parental strain is C. remanei ssp. vulgaris. Males and females back poorly, forward movement unaffected. Males are able to mate. Autosomal. Based on phenotype alone (defective in backward movement), it might be orthologous to unc-4. See WBPaper00002633.
|
|
| PB206 |
C. remanei |
Show Description
Male-female strain. From association with a terrestrial isopod, Trachelipus rathkii, that was collected from the Wright State University Biology Preserve, Dayton Ohio. Species ID confirmed by mating test with EM464.
|
|
| PB212 |
C. remanei |
Show Description
Male-female strain. From association with a terrestrial isopod, Trachelipus rathkii, that was collected from the Wright State University Biology Preserve, Dayton Ohio. Species ID confirmed by mating test with EM464.
|
|
| PB219 |
C. remanei |
Show Description
Male-female strain. From association with a terrestrial isopod, Trachelipus rathkii, that was collected from Cox Arboretum, Dayton Ohio. Species ID confirmed by mating test with EM464.
|
|
| PB227 |
C. remanei |
Show Description
Male-female strain. From association with a terrestrial isopod, Trachelipus rathkii, that was collected from Taylorsville MetroPark, Dayton Ohio. Species ID confirmed by mating test with SB146.
|
|
| PB228 |
C. remanei |
Show Description
Male-female strain. From association with a terrestrial isopod, Armadillidium vulgare, that was collected from Eastwood MetroPark, Dayton Ohio. Species ID confirmed by mating test with SB146.
|
|
| PB229 |
C. remanei |
Show Description
Male-female strain. From association with a terrestrial isopod, Cylisticus convexus, that was collected from Englewood MetroPark, Dayton Ohio. Species ID confirmed by mating test with SB146.
|
|
| PB303 |
C. elegans |
Show Description
Caenorhabditis elegans from association with a terrestrial isopod, Porcellio scaber, that was obtained from Ward's Biological Supply. Species ID confirmed by mating tests with JK574 fog-2(q71). Caenorhabditis elegans wild isolate.
|
|
| PB306 |
C. elegans |
Show Description
Caenorhabditis elegans from association with a terrestrial isopod, Porcellio scaber, that was obtained from Connecticut Valley Biological Supply. Species ID confirmed by mating tests with JK574 fog-2(q71). Caenorhabditis elegans wild isolate.
|
|
| PD126 |
C. elegans |
unc-54(e190) I; ccIs126. Show Description
ccIs126 [myo-2p::lacZ + unc-54(+)]. lacZ expression in pharyngeal and body wall muscles. Superficially wild-type, but gives some paralyzed animals.
|
|
| PD1301 |
C. elegans |
lin-14(cc2841[lin-14::GFP]) X. Show Description
Endogenous lin-14 locus tagged with GFP. Reference: Arribere JA et al. Genetics. 2014 Nov;198(3):837-46.
|
|
| PD2856 |
C. elegans |
unc-54(cc2856[unc-54::gfp]) I. Show Description
Green body muscle filaments, slightly sluggish movement. Functional translational fusion that provides a means to observe striated muscle thick filaments in real time. Reference: Nature. 2016 Jun 30;534(7609):719-23.
|
|
| PD2859 |
C. elegans |
unc-54(cc2859[unc-54::GFP::TAA::NSUTR]) I. Show Description
Endogenous unc-54::GFP made by CRISPR. Exhibits green thick muscle filaments in the body wall muscle. Weakly Unc. Reference: Arribere JA, Cenik ES, Jain N, Hess GT, Lee CH, Bassik MC, Fire AZ. Translation readthrough mitigation. Nature. 2016 Jun 30;534(7609):719-23. Epub 2016 Jun 1.
|
|
| PD3011 |
C. elegans |
cyd-1(cc600) II; cup-5(ar465) III; arIs39 X. Show Description
arIs39 [myo-3p::ssGFP + dpy-20(+)].
|
|
| PD3165 |
C. elegans |
unc-39(ct73) V; ccEx3163. Show Description
ccEx3163 [unc-39p::unc-39 gene (genomic fragment)::GFP::unc-39 3'UTR + rol-6(su1006)]. Maintain by picking Rollers. ccEx3163 carries unc-39 construct pJLY99.1.
|
|
| PD4092 |
C. elegans |
unc-54(cc4092[unc-54::GFP::T2A::nonstop]) I. Show Description
Unc. Reporter for non-stop mRNA decay, separate from non-stop protein decay. Reference: Arribere JA & Fire AZ. ELife, vol. 7, Aug. 2018, doi:10.7554/elife.33292.
|
|
| PD4443 |
C. elegans |
ccIs4443 IV. Show Description
ccIs4443 [arg-1::GFP + dpy-20(+) ]. GFP activity in diverse differentiated non-striated mesodermal lineages. Strain might contain dpy-20(e1282) in background.
|
|
| PD4788 |
C. elegans |
mIs13 I. Show Description
mIs13 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] I. Superficially wild-type. GFP expression in 4-cell embryos, pharyngeal muscle and gut. GFP signal is dim but visible under dissecting scope. See WBG 15 #5 page 20.
|
|
| PD4790 |
C. elegans |
mIs12 II. Show Description
mIs12 [myo-2p::GFP + pes-10p::GFP + F22B7.9::GFP] II. Hermaphrodites expressing compound GFP reporter (see PD4790). Strong pharyngeal muscle expression, easily scored by GFP dissecting scope. mIs12 is tightly linked to unc-4 II, and not to LG III or IV as previously reported. mIs12 homozygous males mate well (ME3). See WBG 15 #5 page 20. See CB5584.
|
|
| PD4792 |
C. elegans |
mIs11 IV. Show Description
mIs11 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] IV. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Strong GFP signal. See WBG 15 #5 page 20.
|
|
| PD4793 |
C. elegans |
mIs10 V. Show Description
mIs10 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] V. WT GFP phenotype, with expression in 4-cell embryos, pharyngeal muscle and gut. Strong GFP signal. Suppresses recombination between unc-60 and dpy-11. See WBG 15 #5 page 20.
|
|
| PD8117 |
C. elegans |
smg-1(cc545) unc-54(r293) I. Show Description
Temperature sensitive. Partially suppressed Unc at 25C. Unc at 16C. [NOTE: The temperature-sensitive allele cc545 causes a T761I change in SMG-1. The lesion is a aca>ata transition in exon 35. Flanking sequences follow with the mutation site indicated with a capital C: tggattattaatcagact gcaaacttttgcattgtgaataaaatgaagaCaccattaggaaaaccaat gcagacttttgcagcttttgagaatgaaatta Pedone ... Reiner G3 (2021).]
|
|
| PD8119 |
C. elegans |
smg-1(cc545) I. Show Description
Temperature sensitive. [NOTE: The temperature-sensitive allele cc545 causes a T761I change in SMG-1. The lesion is a aca>ata transition in exon 35. Flanking sequences follow with the mutation site indicated with a capital C: tggattattaatcagact gcaaacttttgcattgtgaataaaatgaagaCaccattaggaaaaccaat gcagacttttgcagcttttgagaatgaaatta Pedone ... Reiner G3 (2021).]
|
|
| PD8601 |
C. elegans |
ccDf1/dpy-25(e817) II. Show Description
Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy.
|
|
| PD8602 |
C. elegans |
ccDf2/dpy-25(e817) II. Show Description
Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy.
|
|
| PD8603 |
C. elegans |
ccDf3/dpy-25(e817) II. Show Description
Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy.
|
|
| PD8604 |
C. elegans |
ccDf4/dpy-25(e817) II. Show Description
Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy.
|
|
| PD8605 |
C. elegans |
ccDf5/dpy-25(e817) II. Show Description
Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy.
|
|
| PD8607 |
C. elegans |
ccDf7/dpy-25(e817) II. Show Description
Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy. Rec'd new stock 8/2000.
|
|
| PD8611 |
C. elegans |
ccDf11/dpy-25(e817) II. Show Description
Heterozygotes are medium-Dpy and segregate medium-Dpy, strong-Dpy and dead eggs. Maintain by picking medium Dpy.
|
|
| PD8662 |
C. elegans |
lin-31(n301) hlh-1(cc450)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc (mnC1 homozygotes) and larval lethals (lin-31 hlh-1 homozygotes). The lin-31 hlh-1 homozygotes are very Dpy and Lumpy and look like they hatched just after reaching the two-fold stage. See also WBPaper00001975.
|
|
| PD9753 |
C. elegans |
ccIs9753 I. Show Description
ccIs9753 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP]. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Medium-strength GFP signal. See WBG 15 #5 page 20.
|
|
| PE219 |
C. elegans |
dab-1(gk291) II; feEx43. Show Description
feEx43 [dab-1::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. Reference: Holmes et al. J Cell Sci. 2007 Aug 1;120(Pt 15):2741-51.
|
|
| PFR39 |
C. elegans |
hpl-2(tm1489) unc-49(e407) III. Show Description
Unc. Thermosensitive. Sterile at 25C.
|
|
| PFR40 |
C. elegans |
hpl-2(tm1489) III. Show Description
Thermosensitive. Sterile at 25C.
|
|
| PFR60 |
C. elegans |
hpl-1(tm1624) X. Show Description
Wild type phenotype.
|
|
| PG-1 |
Unknown species |
Show Description
Not interfertile with N2. Growth slow. Morphogenesis differs from N2. Collected by M.GALLO. PG-1, -2, -3 appear to be the same species. (Carl Johnson 6/26/93).
|
|
| PG-2 |
Unknown species |
Show Description
Not interfertile with N2. Growth slow. Morphogenesis differs from N2. Collected by M.GALLO. PG-1, -2, -3 appear to be the same species. (Carl Johnson 6/26/93).
|
|
| PG-3 |
Unknown species |
Show Description
Not interfertile with N2. Growth slow. Morphogenesis differs from N2. Collected by M.GALLO. PG-1, -2, -3 appear to be the same species. (Carl Johnson 6/26/93).
|
|
| PHX1364 |
C. elegans |
hsp-12.6(syb1364[hsp-12.6::mKate2]) IV. Show Description
mKate2 tag was inserted into the endogenous hsp-12.6 locus using CRISPR/Cas9. HSP-12.6::mKate2 expression most visible in the muscles. Reference: Koutsoumparis A, et al. Curr Biol. 2022 Apr 26;S0960-9822(22)00581-4. doi: 10.1016/j.cub.2022.04.012. PMID: 35504281
|
|