Search Strains

More Fields
Strain Species Genotype Add
JK6673 C. elegans fzr-1(q1290[3xV5::fzr-1]) II. Show Description
Endogenous fzr-1 locus tagged with 3xV5 close to the N-terminus. Insertion site is a few amino acids downstream of start site (...PAN-3xV5-SPA…). Primer sequences to validate the strain: slc316 GCTTTTGCGTGTTCTCCTCA, slc317 TGAATCCTGAGTCATCATCCGAGT, WT product 347 bp, q1290[3xV5::fzr-1] product 485 bp.
JK6678 C. elegans fbf-1(ok91) fbf-2(q1291[*q973])/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered Y479E substitution. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-2 homozygotes (sterile?). Pick WT dim GFP and check for correct segregation of progeny to maintain.
JK6690 C. elegans qSi422 [*rajSi50] II. Show Description
qSi422 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEa TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. Engineered TGT to ACA substitution in FBEa in rajSi50 gld-1 3’UTR reporter and substitution of downstream G to C to disrupt PAM site. GFP is visible in germline nuclei. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / prHJS401 TGGCAACATGATGTATCGCTGT (~100 bp band in mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."
JK6691 C. elegans qSi423 II. Show Description
qSi423 [gld-1p::GFP::H2B::gld-1 3'UTR(FBEa TGT to ACA & FBEa* TGT to ACA)[*rajSi50] + Cbr-unc-119(+)] II. Modification of gld-1 FBEa and FBEa* in gld-1 3'UTR of single-copy insertion transgene.  Qiu et al., in preparation.
JK6693 C. elegans qSi425 [*rajSi50] II. Show Description
qSi425 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEa TGT to ACA] [FBEb TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. qSi425 contains engineered TGT to ACA substitution in FBEa in rajSi50 gld-1 3’UTR reporter and substitution of downstream G to C to disrupt PAM site, and TGT to ACA substitution in FBEb in rajSi50 gld-1 3’UTR reporter. GFP is visible in germline nuclei. Derived by targeted modification of FBEb in parental strain JK6690. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / prHJS401 TGGCAACATGATGTATCGCTGT (~100 bp band in FBEa mutant, no product in wild-type). Primers to confirm FBEb mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / slc302 GGGTTAGCGTTAAGATAACTGT (~500 bp band in FBEb mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."
JK6721 C. elegans lst-1(q1086) sygl-1(q828) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Pick GFP+ to maintain. PUF-interacting motif B (PIM B) disrupted in endogenous lst-1 locus. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q1086 q828 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock.
JK6722 C. elegans lst-1(q1124) sygl-1(q828) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Pick GFP+ to maintain. PUF-interacting motif A (PIM A) disrupted in endogenous lst-1 locus. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q1124 q828 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock.
JK6736 C. elegans gld-1(q1297[*q1234]) I. Show Description
CRIPSR-engineered modification of gld-1 FBEa* and FBEb in gld-1 3'UTR.  Homozygotes are fertile and 20C. Qiu et al., in preparation.
JK726 C. elegans tra-2(q122) II. Show Description
tra-2(q122) is a gain-of-function allele. Do not distribute this strain; other labs should request it directly from the CGC.
JK816 C. elegans fem-3(q20) IV. Show Description
Gain of function. Temperature sensitive. XX germline makes only sperm at 25C; XX germline makes oocytes and excess sperm at 15C. Do not distribute this strain; other labs should request it from the CGC.
JK845 C. elegans sog-10(q162) dpy-17(e164) III. Show Description
Dpy. Cold-sensitive Fog phenotype; incompletely penetrant, even at 12C. Low percentage of sterile hermaphrodites with an Ooc phenotype. Do not distribute this strain; other labs should request it from the CGC.
JK892 C. elegans unc-32(e189) glp-1(q231)/eT1 III; +/eT1 V. Show Description
Balanced temperature-sensitive allele of glp-1. Maintain at 20-25C. At restrictive temperature (25C), heterozygotes are wild-type and segregate wild-type, Unc-36 eT1 homozygotes, UncSteriles, and arrested eT1 aneuploid progeny (dead eggs). At permissive temperature (15C), heterozygotes are wild-type and segregate wild-type, Unc-36 eT1 homozygotes, fertile Unc-32 (can be maintained as a homozygous stock at 15C), and arrested eT1 aneuploid progeny (dead eggs). Maintain by picking wild-type and check for correct segregation of progeny to maintain. eT1 previously known as unc-36(e873). Do not distribute this strain; other labs should request it from the CGC.
JLF104 C. elegans zyg-9(wow12[ZF1::GFP::SEC::3xFlag::zyg-9]) II; zif-1(gk117) III. Show Description
ZF1-degron, GFP, and 3xFlag tags inserted into endogenous zyg-9 locus. No overt phenotypes in a zif-1(gk117) background. Predicted no degradation because zif-1 putative null is present. Can be used for degradation of zyg-9 protein by providing a source of ZIF-1. GFP fluorescence is observed in microtubules. Reference: Magescas J, et al. eLife. 2019 Jun 27;8:e47867. doi: 10.7554/eLife.47867. PMID: 31246171.
JLF145 C. elegans zif-1(gk117) III; air-1(wow14[air-1::ZF1::GFP::3xFLAG]) V. Show Description
ZF1-degron, GFP, and 3xFLAG tags inserted into endogenous air-1 locus. No overt phenotypes in a zif-1(gk117) background. Predicted no degradation because zif-1 putative null is present. Can be used for degradation of air-1 protein by providing a source of ZIF-1. GFP expression is observed in mitotic cells at the spindle poles and along microtubules. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.
JLF155 C. elegans zif-1(gk117) III. Show Description
Presumptive null deletion allele of zif-1. ZF1-tagged proteins are not degraded in zif-1(gk117) background. Genotyping primers: ExtFwd: gctcgcaacgactgacaagg // IntRev: GGTACTCGCGGAACACTCACTC // ExtRev: ATTCGTACGGTACTTGCATGAACC
JLF16 C. elegans ptrn-1(wow4[ptrn-1::GFP]) X. Show Description
GFP tag inserted into endogenous ptrn-1 locus. No overt phenotypes. GFP fluorescence is observed at non-centrosomal microtubule-organizing centers, including the apical surface of intestinal cells. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.
JLF212 C. elegans par-6(wow31[par-6::ZF1::GFP::3xFLAG]) I; zif-1(gk117) III. Show Description
ZF1-degron, GFP, and 3xFLAG tags inserted into endogenous par-6 locus. No overt phenotypes in a zif-1(gk117) background. Predicted no degradation because zif-1 putative null is present. Can be used for degradation of par-6 by providing ZIF-1. GFP fluorescence is observed at the anterior cortex in zygotes and at apical surfaces in epithelia. Reference: Sallee M, et al. eLife. 2021 Jun 17;10:e64437. doi: 10.7554/eLife.64437. PMID: 34137371.
JLF238 C. elegans tpxl-1(wow34[ZF1::GFP::3xFlag::tpxl-1]) I; zif-1(gk117) III. Show Description
ZF1-degron, GFP, and 3xFLAG tags inserted into endogenous tpxl-1 locus. No overt phenotypes in a zif-1(gk117) background. Predicted no degradation because zif-1 putative null is present. Can be used for degradation of tpxl-1 protein by providing a source of ZIF-1. GFP expression is observed in microtubules. Reference: Magescas J, et al. eLife. 2019 Jun 27;8:e47867. doi: 10.7554/eLife.47867. PMID: 31246171.
JLF24 C. elegans gip-1(wow5[ZF1::GFP::gip-1]) zif-1(gk117) III. Show Description
ZF1-degron and GFP tags inserted into endogenous gip-1 locus. No overt phenotypes in a zif-1(gk117) background. Predicted no degradation because zif-1 putative null is present. Can be used for degradation of gip-1 protein by providing a source of ZIF-1. GFP fluorescence is observed at microtubule-organizing centers. Presence of ZF1-degron targets tagged proteins for ZIF-mediated degradation. Expression of ZIF-1 causes the tagged GIP-1 protein to be degraded. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.
JLF302 C. elegans ebp-2(wow47[ebp-2::GFP::3xFLAG]) II; zif-1(gk117) III. Show Description
GFP and 3xFLAG tags inserted into endogenous ebp-2 locus. No overt phenotypes. GFP fluorescence is observed the tips of growing microtubules. Reference: Sallee M, et al. PLoS Biol. 2018 Aug 6;16(8):e2005189. doi: 10.1371/journal.pbio.2005189. PMID: 30080857.
JLFb1 E. coli E. coli [MG1655 bioB::kan]. Show Description
Biotin auxotrophic E. coli strain is kan resistant and grows fine on LB. This mutant strain produces significantly less biotin and can therefore be used to reduce background in TurboID experiments. Also known as MG1655 bioB::kan and STL110 (J. Cronen, U. of Illinois). References: Sanchez AD & Feldman JL. STAR Protoc. 2021 Dec 2;2(4):100986. doi: 10.1016/j.xpro.2021.100986. PMID: 34927095. Ortega-Cuellar D., et al. J Nutrigenet Nutrigenomics. 2010;3(1):18-30. doi: 10.1159/000318054. PMID: 20798549
JM126 C. elegans pho-1(ca101ca102) II. Show Description
Partial maternal effect lethal. Lack of PHO-1 acid phosphatase activity on isoelectric focusing gel.
JM149 C. elegans caIs71. Show Description
caIs71[elt-2p::GFP::HIS-2B::unc-54 3'UTR + rol-6(su1006)]. Rollers. Expresses nuclear-localized GFP in all intestinal nuclei under control of 5.2 kb elt-2 promoter. GFP is fused to Histone H2B + (fused pie-1 and truncated unc-54 3'-UTR). Transgene was integrated into N2 background by exposure to gamma rays. Reference: Dineen A, et al. Dev Biol. 2018 Mar 15;435(2):150-161. PMID: 29360433
JM311 C. elegans lem-2(ca19) II. Show Description
Overall healthy but reduced brood size and pharyngeal pumping rate. Synthetic lethal with emr-1(-). ca19 is a Leu to Arg mutation at position 16 of LEM-2, reconstituting a mutation in the American Hutterite Population that causes juvenile cataracts and premature cardiomyopathy.
JM47 C. elegans ges-1(ca6) V. Show Description
Phenotypically WT. Isoelectric variant of ges-1 intestinal carboxylesterase.
JM9 C. elegans ges-1(ca1) V. Show Description
Phenotypically WT. Isoelectric variant of ges-1 intestinal carboxylesterase.
JMC101 C. elegans csr-1(tor67[gfp::3xflag::csr-1]) IV . Show Description
GFP and 3xFLAG tags inserted into second exon of endgonenous csr-1 locus; tags both isoforms. Reference: Ouyang JPT, et al. Dev Cell. 2019 Sep 23;50(6):716-728.e6. PMID: 31402283
JMC151 C. elegans csr-1(tor160[csr-1 exon1::GFP::FLAG (IV:7957568)]) IV . Show Description
GFP and 3xFLAG tags inserted into first exon of endgonenous csr-1 locus (IV:7957568); specifically tags a-isoform.
JMC164 C. elegans csr-1(tor67[csr-1 exon2::GFP::FLAG IV:7958598]csr- 1(mg660[G120*]) IV) IV . Show Description
Null allele of csr-1 with GFP and 3xFLAG tags inserted into second exon of endgonenous csr-1 locus. tor67 would normally tag both long and short isoforms, but the mg660 allele introduces a stop codon into the first exon so the long isoform is not made and only tagged CSR-1B isoform is produced.
JMC192 C. elegans wago-10(tor133) V. Show Description
Null allele of wago-10. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
JMC193 C. elegans sago-2(tor135) I. Show Description
Null allele of sago-2; detectable by PCR/restriction digest. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013
JMC245 C. elegans alg-4(tm1184) III; csr-1(tor67[csr-1 exon2::gfp::3xflag (IV:7958598)], csr-1(mg660[G120*])) alg-3(tm1155) IV; wago-10(tor133) V. Show Description
Quadruple mutant of four spermatogenesis-specific ago genes. Reference: Charlesworth AG, et al. Nucleic Acids Res. 2021 Sep 7;49(15):8836-8865. PMID: 34329465
JN1239 C. elegans daf-18(pe407) IV. Show Description
pe407 suppresses the defects in salt-starve associative learning of casy-1(tm718). Reference: Ohno H, et al. Science. 2014 Jul 18;345(6194):313-7. PMID: 25035490
JN1240 C. elegans plc-1(pe1238) X. Show Description
Presumptive null allele of plc-1. Shows a preference for low salt concentrations. Reference: Kunitomo H, et al., 2013, Nat Commun. 2013;4:2210. doi: 10.1038/ncomms3210.
JN1483 C. elegans daf-18(pe407) IV. Show Description
pe407 suppresses the defects in salt-starve associative learning of casy-1(tm718). Reference: Ohno H, et al. Science. 2014 Jul 18;345(6194):313-7. PMID: 25035490
JN1484 C. elegans daf-18(pe408) IV. Show Description
pe408 suppresses the defects in salt-starve associative learning of casy-1(tm718). Reference: Ohno H, et al. Science. 2014 Jul 18;345(6194):313-7. PMID: 25035490
JN2113 C. elegans peIs2113. Show Description
peIs2113 [gcy-21p::mCaspase + tax-4p::NLS::YC2.60 + lin-44p::GFP]. Genetic ablation of ASG neurons by specific expression of caspase. tax-4p::YC2.60 facilitates calcium imaging. Reference: Jang MS, et al. Proc Natl Acad Sci U S A. 2019 Sep 10;116(37):18673-18683. PMID: 31455735
JN215 C. elegans iff-1(tm483) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Segregates GFP+ glowing heterozygotes and non-glowing sterile iff-1 homozygotes. tm483 is a UV/TMP-induced iff-1 deletion allele generated by K. Gengyo-Ando and S. Mitani. hT2[qIs48] homozygotes inviable. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
JN2512 C. elegans peIs422. Show Description
peIs422 [gcy-5p::Downward DAG2(worm) + gcy-5p::mCherry + unc-122p::mCherry]. Transgene allows imaging of changes in the amount of diacylglycerol (DAG) in ASER neuron. Reference: Ohno H, et al. Cell Rep. 2017 Sep 5;20(10):2294-2303. PMID: 28877465
JN578 C. elegans peIs578. Show Description
peIs578 [npr-9p::casp1 + npr-9p::Venus + unc-122p::mCherry]. AIB neurons are ablated by specific expression of caspase. Reference: Kunitomo H, et al., 2013, Nat Commun. 2013;4:2210. doi: 10.1038/ncomms3210.
JN579 C. elegans peIs579. Show Description
peIs579 [ttx-3p::casp1 + ttx-3p::Venus + lin-44p::GFP]. AIY neurons are ablated by specific expression of caspase. Reference: Kunitomo H, et al., 2013, Nat Commun. 2013;4:2210. doi: 10.1038/ncomms3210.
JN580 C. elegans peIs580. Show Description
peIs580 [ins-1p(short)::casp1 + ins-1p(short)::Venus + unc-122p::GFP]. AIA neurons are ablated by specific expression of caspase. Reference: Kunitomo H, et al., 2013, Nat Commun. 2013;4:2210. doi: 10.1038/ncomms3210.
JN930 C. elegans egl-30(pe914) I. Show Description
Presumptive gain-of-function mutant shows defects in salt-food associative learning and olfactory learning. Reference: Tomioka M, et al. 2006 Sep 7;51(5):613-25. PMID: 16950159
JPS325 C. elegans slo-1(js379)V; vxEx325. Show Description
vxEx325 [slo-1p::hslo(T352I)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx325 rescues ethanol-independent phenotypes of a slo-1(null) mutants without rescuing ethanol intoxication. vxEx325 expresses human BK channel protein (hslo(T352I)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.
JPS327 C. elegans slo-1(js379)V; vxEx327. Show Description
vxEx327 [slo-1p::slo-1(T381I)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx327 rescues ethanol-independent phenotypes of a slo-1(null) mutants without rescuing ethanol intoxication. vxEx327 expresses worm BK channel protein (slo-1(T381I)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.
JPS338 C. elegans slo-1(js379)V; vxEx338. Show Description
vxEx338 [slo-1p::hslo(+)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx338 rescues ethanol-independent and ethanol intoxication phenotypes of a slo-1(null) mutants. vxEx338 expresses human BK channel protein (hslo(+)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.
JPS344 C. elegans slo-1(js379)V; vxEx344. Show Description
vxEx344 [slo-1p::slo-1(+)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx344 rescues ethanol-independent and ethanol intoxication phenotypes of a slo-1(null) mutants. vxEx344 expresses worm BK channel protein (slo-1(+)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.
JPS383 C. elegans slo-1(js379)V; vxEx383. Show Description
vxEx383 [myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. Resistant to the effects of ethanol. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.
JPS428 C. elegans slo-1(gk602291) V. Show Description
Resistant to the effects of ethanol on egg-laying and locomotion. Derived by outcrossing Million Mutation Project strain VC40372 and verification that this outcrossed strain retains the slo-1(gk602291) allele and resistance to ethanol. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.
JPS481 C. elegans vxEx280. Show Description
vxEx280 [sto-5p::ICE + gcy-8::ICE + myo-2p::mCherry]. Pick mCherry+ animals to maintain. Genetic ablation of AFDL, AFDR, FLPL, FLPR, BDUL, and BDUR via expression of a human cell death caspase (ICE). Reference: Russell J, et al. Proc Natl Acad Sci USA. 2014 Jun 3;111(22):8269-74.