Strain Information
| Name | JLF155 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | zif-1(gk117) III. |
| Description | Presumptive null deletion allele of zif-1. ZF1-tagged proteins are not degraded in zif-1(gk117) background. Genotyping primers: ExtFwd: gctcgcaacgactgacaagg // IntRev: GGTACTCGCGGAACACTCACTC // ExtRev: ATTCGTACGGTACTTGCATGAACC |
| Mutagen | |
| Outcrossed | x6 |
| Made by | Jenny Zonka |
| Laboratory | JLF |
| Reference | Sallee et al., PLoS Biol 2018 |
Sign in
or
register an account if you want to order this strain.