Search Strains

pie-1(ne4301) inserted GFP into pie-1 locus tagging endogenous pie-1 with GFP. mex-5(egx1[F294N, F339N]) modifies the endogenous mex-5 locus to disrupt zinc finger motifs. Reference: Han et al, Current Biology 2017.

mex-5(egx1[F294N, F339N]) modifies the endogenous mex-5 locus to disrupt zinc finger motifs. Reference: Han et al, Current Biology 2017.

egxSi100 [mex-5p::GFP::pos-1 + unc-119(+)] II. Single-copy transgene expressing GFP::POS-1. Reference: Han et al, Current Biology 2017.

egxSi101 [mex-5p::GFP::pos-1(F121N & F164N) + unc-119(+)] II. Single-copy transgene expressing mutated POS-1 with GFP tag. GFP::POS-1 is uniformly distributed in the one-cell zygote. Reference: Han et al, Current Biology 2017.

egxSi100 [mex-5p::GFP::pos-1 + unc-119(+)] II. Single-copy transgene expressing GFP::POS-1. mex-5(egx1[F294N, F339N]) modifies the endogenous mex-5 locus to disrupt zinc finger motifs. Reference: Han et al, Current Biology 2017.

egxSi100 [mex-5p::GFP::pos-1 + unc-119(+)] II. Single-copy transgene expressing GFP::POS-1. Reference: Han et al, Current Biology 2017.

egxSi136 [mex-5p::tomm-20::halotag::pie-1 3’UTR + unc-119(+)] II. GFP and 3xFLAG tags inserted into endogenous cox-4 locus to create a C-terminal translational GFP fusion. Outer membranes are stably labeled with the TOMM-20::Halotag transgene, and the mitochondria matrix are labeled with COX-4::GFP. Reference: Fan X, et al. G3 (accepted).

bc364 deletes 1,109 bp between AACATCTTGAATAACCATTCGGGAAGT and AAGTCATTCATTGCAGAGCTTACATTTAGTA. References: Kemp BJ, et al. Genetics. 2009 Feb;181(2):581-91.

Starvation sensitive gonadogenesis defect.

Heterozygotes are WT and segregate WT, Uncs and dead eggs.

Unc. Temperature senstive for both gon-2 and fer-1. Maintain at 15C. Will also grow at 20C. Received new stock 10/12/00 from EJ.

Temperature sensitive for both gon-2 and fer-1. Maintain at 15C. Will also grow at 20C.

Him. Heterozygotes are WT and segregate WT, Sterile Evul and Dpys.

cmEx6 [(pBR126) mbk-2p::GFP + rol-6(su1006)]. Maintain by picking Rollers.

cmIs6 [(pBR104) mbk-1::GFP + pNC4.21].

cldIs5 [pie-1p::capg-1::GFP + unc-119(+)]. GFP tagged CAPG-1 driven by the pie-1 promoter; expression is detected in the germline and in embryos. References: Collette K, et al. J Cell Sci. 2011 Nov 1;124(Pt 21):3684-94. Bembenek JN, et al. Curr Biol. 2013 Jun 3;23(11):937-46.

Heterozygotes are Unc and segregate additional hets, Unc-76 om40 homozygotes and dead eggs. om40 animals have multiple germline defects.

Heterozygotes are WT and segregate WT, Sterile Uncs and Dpys. bli-4 is suppressed by dpy-18 in hT2 homozygotes-only see a very few DpyBli.

om33 chromosome contains a linked fer-6 allele and a linked Mel. Mel probably not associated with om33, but they have not been separated. Best grown at 15C.

Heterozgyotes are WT and segregate WT, Steriles and Dpys. The Steriles produce small, abnormal oocytes; some dead embryos are produced in late adulthood. bli-4 is suppressed by dpy-1 in hT2 homozygotes-only see a very few DpyBli. om58 previously called ego-6(om58).

Heterozygotes are WT and segregate WT, mild Unc that are Sterile, and Dpys. bli-4 is suppressed by dpy-18 in hT2 homozygotes-only see a very few DpyBli.

Heterozygotes are WT and segregate WT, Dpy sC1 homozygotes, and bc367 homozygotes which arrest as late L1/early L2 larvae (survive for a few days, then die).

omIs1 [met-2p::met-2::GFP + Cbr-unc-119(+)] II. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.

ubr-5(om2) is a deletion predicted to severely truncate the UBR-5 protein. ubr-1 also known as sog-1. Reference: Safdar K, et al. G3 (Bethesda). 2016 Jul 7;6(7):2125-34. doi: 10.1534/g3.116.027805. PMID: 27185398.

Unc. Fertile with viable progeny at or below 20C. Glp-1 sterile at higher temperatures. No obvious visible phenotype associated with sog-3.

Temperature sensitive. Missing Ray. Swollen tail and reduced fan. Temperature sensitive lethal at all stages. Wrinkled spicule.

Strain throws WT, DpyUncs and males (and some Lon-don't know where these come from??). Maintain by picking WT. non-Unc non-Dpy males mate at low frequency and will transmit stDp2.

lep-2/Y55F3AM.6 reference allele. Him. Reference: Herrera RA, et al. Development. 2016 Mar 1;143(5):799-809. doi: 10.1242/dev.132738. PMID: 26811380.

Conditional lethal: inviable when grown at 25C. Wild type at 16C. Viable when grown at 20C; partial ray loss at 20C. Shifting males during ray assembly to non-permissive temperature results in ray loss. No lineage defect.

Ray 3 and 4 fusion >60% at non-permissive temp. Ray 1 and 2 fusion about 10% at non-permissive temp. ts period is around L3-L4.

Extensive ray fusion involving all 9 rays. Larva have Vab phenotype with decreasing expressivity in adult. Hermaphrodites have swollen tail and anus. bx80 pka mab-26(bx80).

WT strain, Pellioditis pelhamensis. See WBG 12(5)14. Male/Female strain. Previously and incorrectly called Rhabditis maupasi by the CGC. Also previously called DF5039.

WT strain, Pelodera teres. See WBG 12(5) 14. Male/Female strain. Previously called DF5016.

Unc. Round bulging adult male tale. Very reduced fan. Mating efficiency is zero.

bxIs14 [pkd-2::GFP + pdx-1]. Ray axon defective.

bxIs14 [pkd-2::GFP + pdx-1]. Ray axon defective.

bxIs14 [pkd-2::GFP + pdx-1]. Ray axon defective.

bxIs14 [pkd-2::GFP + pdx-1]. Ray axon defective.

bxIs14 [pkd-2::GFP + pdx-1]. Ray axon defective.

bxIs14 [pkd-2::GFP + pdx-1]. Ray axon defective.

bxIs14 [pkd-2::GFP + pdx-1]. Ray axon defective.

Male leaving assay defective (Las), lethargic, hypereversal. Reference: Barrios, A, et al. Nat Neurosci. 2012 Dec;15(12):1675-82.

Weakly resistant to 1mM levamisole in acute screen. Animals become paralyzed after >30 min but nose remains hypercontracted. Sluggish Unc. pka lev-10.

ctIs40 [dbl-1(+) + sur-5::GFP]. Lon. dbl-1 over-expressiong from ctIs40.

Derived from RB1739 and NU3.

ctIs40 [dbl-1(+) + sur-5::GFP].

Small. Derived from MT15024 and NU3.

Derived from RB1739 and RB911.

Derived from RB1739 and KU4.

Derived from RB1739 and DA465.