EJ810 |
C. elegans |
F25H2.5(ok314)/hT2 [dpy-18(h662)] I; +/hT2 [bli-4(e937)] III; him-8(e1489) IV. Show Description
Him. Heterozygotes are WT and segregate WT, Sterile Evul and Dpys.
|
|
RB2310 |
C. elegans |
T16G12.1(ok3142) III. Show Description
T16G12.1 Homozygous. Outer Left Sequence: caacccaacttttgccaact. Outer Right Sequence: tgcttatttggatgccatga. Inner Left Sequence: ctttttgggctcagacttcg. Inner Right Sequence: ggacaactctcgactttgatga. Inner Primer PCR Length: 1326. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB2311 |
C. elegans |
R03G8.6(ok3143) X. Show Description
R03G8.6 Homozygous. Outer Left Sequence: tgacatacgactcgacccaa. Outer Right Sequence: cggttttcaattgcgttttt. Inner Left Sequence: cggtccctagtaagctccaa. Inner Right Sequence: tgttgattttgcaaccgaaa. Inner Primer PCR Length: 1289. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB2312 |
C. elegans |
F40B5.1(ok3144) X. Show Description
F40B5.1 Homozygous. Outer Left Sequence: taaatttcgagagccggatg. Outer Right Sequence: acgctttgtgcaagagtgtg. Inner Left Sequence: atggaggataacgcaaggaa. Inner Right Sequence: gaaagaggtgagcctggaga. Inner Primer PCR Length: 1192. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB2313 |
C. elegans |
F40B5.1(ok3145) X. Show Description
F40B5.1 Homozygous. Outer Left Sequence: taaatttcgagagccggatg. Outer Right Sequence: acgctttgtgcaagagtgtg. Inner Left Sequence: atggaggataacgcaaggaa. Inner Right Sequence: gaaagaggtgagcctggaga. Inner Primer PCR Length: 1192. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB2314 |
C. elegans |
Y42H9AR.1(ok3146) IV. Show Description
Y42H9AR.1 Homozygous. Outer Left Sequence: tcagtaaatcgcaggcagtg. Outer Right Sequence: gttggtgctgaagttgcaga. Inner Left Sequence: ttgtgccatctcaaaattgg. Inner Right Sequence: cgtaggatacgacggtggag. Inner Primer PCR Length: 1166. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB2315 |
C. elegans |
T27A8.1(ok3147) X. Show Description
T27A8.1 Homozygous. Outer Left Sequence: atgctaatccggcacttcac. Outer Right Sequence: atctttattgcgttggtcgg. Inner Left Sequence: aaagaaggagaagtctcgacca. Inner Right Sequence: atgccccctaattttatgcc. Inner Primer PCR Length: 1177. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB2316 |
C. elegans |
str-2(ok3148) V. Show Description
C50C10.7 Homozygous. Outer Left Sequence: tcgacctgtcaaacatcgaa. Outer Right Sequence: cgcatttgtgaacctgtttg. Inner Left Sequence: aaatcctcgtcgataacttttga . Inner Right Sequence: gcacacatatgggtctgcttt. Inner Primer PCR Length: 1212. Deletion size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB2317 |
C. elegans |
T13C5.5(ok3149) X. Show Description
T13C5.5 Homozygous. Outer Left Sequence: gcgctatggttcttgaaagc. Outer Right Sequence: ccggtttgcaaggtttagtc. Inner Left Sequence: ttgtaacaaaaattgccccc. Inner Right Sequence: gatttgaatggcgatcttgag. Inner Primer PCR Length: 1279. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2349 |
C. elegans |
cpg-7(ok3141) II. Show Description
K09E4.6. External left primer: GAAAAATCTACACCGGCCAA. External right primer: CACCCTGCCTTCTTCACATT. Internal left primer: ATCGGGAGGACTCGAAAAGT. Internal right primer: CAGCTTTTGTCTCAGGCGAT. Internal WT amplicon: 1242 bp. Deletion size: 383 bp. Deletion left flank: AGATGATTCAAGGGTTGCATCACCGGATCC. Deletion right flank: ATATAGGCATATAGGCATATAGGCATATAGGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2410 |
C. elegans |
sma-4(ok3140) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
R12B2.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3140 homozygotes (late larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GACGGAAAGGTGTTCCACAT. External right primer: GGTCCGTGCAGAAAATCAGT. Internal left primer: CGCAAGAATATGGAGATGGC. Internal right primer: TGCTCGTACTGCTTCATTGC. Internal WT amplicon: 1288 bp. Deletion size: 718 bp. Deletion left flank: AGAGGTGGCTGCTCTCTCTCTCTGACTTTT. Deletion right flank: TTCGTCCGATCCGGGTACCTAGACTACACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|