| EL732 |
C. elegans |
smrc-1(om145[3xmyc::smrc-1]) III. Show Description
3xmyc tag inserted at N-terminus of endogenous smrc-1 locus using Crispr/Cas9. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
|
|
| EM105 |
C. elegans |
mab-21(bx41) III; him-5(e1490) V. Show Description
Transformation of ray 6 to a thin ray which is anteriorly displaced and fuses with ray 4 (95%). A 10th ray is found in about 50% of the sides scored. Body is slightly shorter.
|
|
| EM111 |
C. elegans |
him-5(e1490) V; mab-19(bx38) X. Show Description
Male phenotype: loss of rays 7-9; incomplete penetrance/expressivity (80%); T lineage defect. Hermaphrodite phenotype: lowered brood size (100 progeny/hermaphrodite). Hypomorphic allele: uDf1/mab-19(bx38) results in embryonic arrest during morphogenesis.
|
|
| EM128 |
C. elegans |
mab-21(bx53) III; him-5(e1490) V. Show Description
Transformation of ray 6 to a thin ray which is anteriorly displaced and fuses with ray 4 (95%). A 10th ray is found in about 50% of the sides scored. Slightly shorter than WT. mab-21(bx53)/yDf10 is embryonically lethal with embryo arrest at 2 fold stage.
|
|
| EM185 |
C. elegans |
tra-1(e1099) III; ram-5(bx30) X; eDp6 (III;f). Show Description
Animals with the duplication are WT. XX Animals which have lost the duplication are males (low fertility-gonad morphology variable). Rays abnormal. See also WBPaper0000498.
|
|
| EM331 |
C. elegans |
him-5(e1490) V; mab-19(bx83) X. Show Description
Male phenotype: loss of rays 7-9; incomplete penetrance/expressivity (80%); T lineage defect. Hermaphrodite phenotype: lowered brood size (100 progeny/hermaphrodite). Hypomorphic allele: uDf1/mab-19(bx83) results in embryonic arrest during morphogenesis.
|
|
| EM347 |
C. elegans |
tlp-1(bx85) IV; him-5(e1490) V. Show Description
Although hermaphrodites appear WT in other ways, there are some problems with T cell lineages (affecting the phasmids) and tail cell fusions. Variably Dyf. Male tail tip morphogenesis is also defective, resulting in blobby, "leptoderan" tails. Males are infertile due to an inability to properly copulate. tlp-1 encodes a nuclear protein with a single C2H2-type zinc finger domain and an N-terminal "SPLALLA" domain, similar to that of Sp1 transcription factors of vertebrates. The bx85 mutation involves a truncation of TLP-1 due to a frameshift caused by a 5-bp deletion.
|
|
| EM435 |
Oscheius myriophilus |
Oscheius myriophilus wild isolate. Show Description
WT strain. Isolated by D. Fitch in June 1990 from soil in Scott Emmons' compost heap in the Fort Greene section of Brooklyn, NY. A second strain, DF5038, was isolated from the same location one year later from the head and ventral segments of a male pill bug (Armadillidium vulgare). Hermaphroditic. Males are easily isolated by heat shocking L4 or early adult hermaphrodites at 30C for 6-12 hrs. Grows well at 6-25C on OP50. Dauer larvae accumulate under starved or overcrowded conditions. Freezes easily using C. elegans protocols with 90% viability. Previously called Rhabditis sp. See also WBPaper00003418. Formerly known as Oscheius myriophila.
|
|
| EM464 |
C. remanei ssp. vulgaris |
Show Description
Male-female strain. Reference WBG 11(4):89. See also WBPaper00001874. May crawl off the plates. Previously called C. vulgaris BK and C. vulgariensis BK. Walter Sudhaus has tentatively described this strain as C. remanei ssp. vulgaris; this description is not official and is contigent upon its being published. See WBPaper00002633 and WBPaper00003993.
|
|
| EM489 |
C. elegans |
pal-1(e2091) III; him-5(e1490) V; dpy-22(bx92) X. Show Description
V6 produces rays instead of alae in pal-1; sop01 mutants. No obvious phenotype in a pal-1(+) background. Previously called sop-1(bx92).
|
|
| EM490 |
C. elegans |
pal-1(e2091) III; him-5(e1490) V; dpy-22(bx93) X. Show Description
V6 produces rays instead of alae in pal-1; sop01 mutants. No obvious phenotype in a pal-1(+) background. Previously called sop-1(bx93).
|
|
| EM493 |
C. elegans |
sop-3(bx96) I; pal-1(e2091) III; him-5(e1490) V. Show Description
V6 produces rays instead of alae in sop-3; pal-1 mutants.
|
|
| EM496 |
C. elegans |
hlh-2(bx108) I; him-5(e1490) V; lin-32(e1926) X. Show Description
Males are rayless. hlh-2(bx108) strongly and semi-dominantly enhances the ray-loss phenotype of lin-32(e1926).
|
|
| EM507 |
C. elegans |
pal-1(e2091) III; him-5(e1490) V; dpy-22(bx103) X. Show Description
V6 produces rays instead of alae in pal-1; sop-1 mutants. No obvious phenotype in a pal-1(+) background. Previously called sop-1(bx103).
|
|
| EM511 |
C. elegans |
pal-1(e2091) III; him-5(e1490) V; dpy-22(bx107) X. Show Description
V6 produces rays instead of alae in pal-1; sop01 mutants. No obvious phenotype in a pal-1(+) background. Previously called sop-1(bx107).
|
|
| EM599 |
C. elegans |
him-5(e1490) V; lin-15B&lin-15A(n765) X; bxIs13. Show Description
bxIs13 [egl-5::GFP + lin-15(+)]. Him. egl-5::GFP reporter made from EM#286 (GFP inserted within the last few amino acids of the C-terminus) by integrating bxEx30 in EM588. High nuclear expression of transgene in males (good in seam cells, none in rectal epithelium), weak expression in hermaphrodites. Expression in 2-4 head neurons in males and hermaphrodites. egl-5 gene on reporter does not rescue egl-5(-).
|
|
| EM66 |
C. elegans |
him-5(e1490) V; vab-3(bx23) X. Show Description
Transformation of ray 6 to a thin ray which is anteriorly displaced and fuses with ray 4 (99%). Body is slightly shorter. See also WBPaper00002235.
|
|
| EM67 |
C. elegans |
mab-20(bx24) I; him-5(e1490) V. Show Description
Extensive ray fusion. Posterior portion of body swollen at larval stages.
|
|
| EN5271 |
C. elegans |
(kr5271) I. Show Description
Mos1 transposon insertion in LG I. Presence of Mos1 can be detected using oligos oJL115 (Mos1 5'gctcaattcgcgccaaactatg3') and oVR261 (Chr I 5'gaaatagagggcagttcaacg3'). Reference: Giordano-Santini R, et al., (2010) Nature Methods. Aug 22.
|
|
| EN5273 |
C. elegans |
(kr5273) X. Show Description
Mos1 transposon insertion in LG X. Presence of Mos1 can be detected using oligos oJL115 (Mos1 5'gctcaattcgcgccaaactatg3') and oVR266 (Chr X 5'gacaaagacgtgtagttgcg3'). Reference: Giordano-Santini R, et al., (2010) Nature Methods. Aug 22.
|
|
| EN909 |
C. elegans |
krIs14 V. Show Description
krIs14 [hsp-16.48p::MosTransposase + lin-15B + unc-122p::GFP]. GFP expression in coelomocytes. Derived by integration of oxEx166. Reference: Toraason E, et al. STAR Protoc. 2021 Sep 8;2(3):100801. doi: 10.1016/j.xpro.2021.100801. PMID: 34527958.
|
|
| ENL20 |
C. elegans |
mir-80(nDf53) III; daf-1(m213) mir-58.1(n4640) IV; mir-81&mir-82(nDf54) X. Show Description
Maintain at 15C. Temperature-sensitive dauer constitutive.
|
|
| ENL21 |
C. elegans |
daf-2(e1370) mir-80(nDf53) III; mir-58.1(n4640) IV; mir-81&mir-82(nDf54) X. Show Description
Maintain at 15C. Temperature-sensitive dauer constitutive (daf-c).
|
|
| ENL54 |
C. elegans |
daf-2(e1370) III; mir-58.1(n4640) IV; mir-81&mir-82(nDf54) X. Show Description
Maintain at 15C. Temperature-sensitive dauer constitutive.
|
|
| ENL55 |
C. elegans |
daf-2(e1370) mir-80(nDf53) III; mir-81&mir-82(nDf54) X. Show Description
Maintain at 15C. Temperature-sensitive dauer constitutive.
|
|
| ENL62 |
C. elegans |
daf-16(mu86) I; sma-10(ok2224) IV. Show Description
Derived from RB1739 and CF1038.
|
|
| ENL63 |
C. elegans |
daf-16(mgDf47) I; sma-10(ok2224) IV; xrIs87. Show Description
xrIs87 [daf-16(alpha)::GFP::daf-16B + rol-6(su1006)]. Rollers. Derived from RB1739 and GR1352.
|
|
| ENL67 |
C. elegans |
daf-16(mgDf47) I; sma-10(ok2224) IV; muIs61. Show Description
muIs61 [(pKL78) daf16::GFP + rol-6(su1006)]. muIs61 rescues daf-16(mu86). muIs61 is a gamma-induced insertion of muEx50. Derived from RB1739 and CF1139.
|
|
| ENL68 |
C. elegans |
sma-10(ok2224) zIs356 IV. Show Description
zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)]. See strain TJ356 for additional information about zIs356. Derived from RB1739 and TJ356.
|
|
| ENL70 |
C. elegans |
daf-2(e1370) III; sma-10(ok2224) IV. Show Description
Derived from RB1739 and CB1370.
|
|
| ER10 |
C. elegans |
unc-123(jd5) III. Show Description
Temperature sensitive, semidominant mutant that is Unc when moving backward. Dorsal muscular contraction is stronger than that of ventral, resulting in an asymmetric pattern of locomotion in which the animal either forms a dorsal coil or moves in circles with the dorsal side central to the circle. Most likely a gain of function allele of sup-1.
|
|
| ER50 |
C. elegans |
unc-123(jd5jd10) III. Show Description
Recessive suppressor of unc-123(jd5). Exhibits a subtle dorsal asymmetric locomotory defect as a homozygote when grown at 25C. Dominant suppressor of unc-17(e245). Most likely unc-123 is allelic with sup-1.
|
|
| ERC82 |
C. elegans |
ieSi57 II; ers54[dpy-27::AID*::GFP] III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID*::GFP tag inserted into the endogenous dpy-27 locus. Dumpy, Him, X chromosome dosage compensation hypomorph. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Morao AK, et al. Mol Cell. 2022 Nov 17;82(22):4202-4217.e5. doi: 10.1016/j.molcel.2022.10.002. PMID: 36302374.
|
|
| ERC83 |
C. elegans |
ieSi57 ers55[top-2::AID*::GFP] II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID* tag inserted into the endogenous top-2 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Morao AK, et al. Mol Cell. 2022 Nov 17;82(22):4202-4217.e5. doi: 10.1016/j.molcel.2022.10.002. PMID: 36302374.
|
|
| ERC84 |
C. elegans |
top-1(ers56[top-1::AID*::GFP]) I; ieSi57 II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID* tag inserted at the end of exon five in the endogenous top-1 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Morao AK, et al. Mol Cell. 2022 Nov 17;82(22):4202-4217.e5. doi: 10.1016/j.molcel.2022.10.002. PMID: 36302374.
|
|
| ERS100 |
C. elegans |
eraIs1. Show Description
eraIs1 [dat-1p::mCherry + dat-1p::hSNCA::Venus]. Inclusions of human alpha-Synuclein::Venus in dopaminergic neurons with marked with mCherry. Overexpression of human SNCA (alpha-Synuclein tagged with Venus) causes degenerative signs in dopaminergic neurons. Reference: Vozdek R, et al. 2022 Apr 27:14:806000. doi: 10.3389/fnagi.2022.806000. PMID: 35572147.
|
|
| ERT60 |
C. elegans |
jyIs13 II. Show Description
jyIs13 [act-5p::GFP::ACT-5 + rol-6(su1006)] II. Rollers with GFP localized to apical side of intestine. Reference: Szumowski SC, et al. Cell Microbiol. 2015 Jul 6. PMID:26147591.
|
|
| ERT691 |
C. elegans |
rcs-1(jy84) X. Show Description
Full CRISPR deletion of rcs-1 via CRISPR in a dpy-10 background, outcrossed 3x to wild-type. Superficially wild-type. Reference: Panek J, et al. Proc Natl Acad Sci USA. .2020 Apr 7;117(14):7950-7960. doi: 10.1073/pnas.1918417117. PMID: 32193347.
|
|
| ERT848 |
C. elegans |
fbxa-75(jy143) III. Show Description
Full CRISPR deletion of fbxa-75 via CRISPR in a dpy-10 background, outcrossed 3x to wild-type. Superficially wild-type. Reference: Panek J, et al. Proc Natl Acad Sci USA. .2020 Apr 7;117(14):7950-7960. doi: 10.1073/pnas.1918417117. PMID: 32193347.
|
|
| ERT852 |
C. elegans |
fbxa-158(jy145) II. Show Description
Full CRISPR deletion of fbxa-158 via CRISPR in a dpy-10 background, outcrossed 3x to wild-type. Superficially wild-type. Reference: Panek J, et al. Proc Natl Acad Sci USA. .2020 Apr 7;117(14):7950-7960. doi: 10.1073/pnas.1918417117. PMID: 32193347.
|
|
| ESC254 |
C. elegans |
dao-5(cse254[GFP::dao-5]) I. Show Description
GFP tag inserted into the N-terminus of endogenous dao-5 locus. maintain at 16-20C. Nucleolar GFP expression. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.
|
|
| ESC319 |
C. elegans |
rpoa-2(cse319[degron::GFP::rpoa-2]) I. Show Description
Maintain at 15-20C. degron::GFP tag inserted into the N-terminus of endogenous rpoa-2 locus. Nucleolar GFP expression. Reference: Zhao Q., et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
|
|
| ESC332 |
C. elegans |
rpoa-2(cse319[AID*::GFP::rpoa-2]) I; ieSi57 II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Maintain at 15-20C. AID* and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in somatic tissues. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
|
|
| ESC351 |
C. elegans |
rpoa-2(cse319[AID*::GFP::rpoa-2]) I; reSi2 II. Show Description
reSi2 [col-10p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Maintain at 15-20C. AID* and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in hypodermis. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
|
|
| ESC352 |
C. elegans |
qzIs15[rpoa-2p::AID*::GFP::rpoa-2] I; ieSi60 II. Show Description
ieSi60 [myo-2p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Maintain at 15-20C. AID* and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in pharyngeal muscle. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
|
|
| ESC360 |
C. elegans |
rpoa-2(cse319[AID*::GFP::rpoa-2]) I; emcSi71 IV. Show Description
emcSi71 [myo-3p::TIR1::mRuby] (IV: -0.05). Maintain at 15-20C. AID* and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in muscles. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
|
|
| ESC373 |
C. elegans |
rpoa-2(cse319[AID*::GFP::rpoa-2]) I; ieSi61 II. Show Description
ieSi61 [ges-1p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Maintain at 15-20C. AID* and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in the intestine. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
|
|
| ESC374 |
C. elegans |
rpoa-2(cse319[AID*::GFP::rpoa-2]) I; ieSi38 IV. Show Description
ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Maintain at 15-20C. AID* and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in germ line and early embryos. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
|
|
| ESC424 |
C. elegans |
tsr-2(cse424[tsr-2::degron::GFP]) IV. Show Description
Maintain at 15-20C. degron::GFP tag inserted into the C-terminus of endogenous tsr-2 locus. Nucleolar GFP expression. Reference: Zhao Q., et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
|
|
| ESC432 |
C. elegans |
grwd-1(cse432[grwd-1::degron::GFP]) III. Show Description
Maintain at 15-20C. degron::GFP tag inserted into the C-terminus of endogenous grwd-1locus. Nuclear GFP expression. Reference: Zhao Q., et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
|
|