Search Strains

Unc. Recessive. M-MATING++ 1-10%WT. W176Stop, a "C" to "T" mutation at 3305 on the T08G11 cosmid.

Temperature sensitive. Sterile at 25C. Maintain at 15C. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. [2/98: Craig Mello noticed a different embryonic phenotype in this strain as compared to the e2141 stock that Jim Priess obtained from England-the ABp fate appears WT.] [NOTE (11/16/10 - J. Hubbard): This strain is NOT synonymous with glp-1(e2144) as previously reported in Kodoyianni V, Maine EM, Kimble J. (1992) [Molecular basis of loss-of-function mutations in the glp-1 gene of Caenorhabditis elegans. Mol Biol Cell. 3,1199-213. PMID: 1457827]. As reported in Worm Breeders Gazette December 2010; 18(3), e2144 carries the mutation c2785t in exon 8, leading to the amino acid change L929F, whereas e2141 carries the mutations c2920t and a3610g in exon 8, leading to the amino acid changes R974C and T1204A.]

e2008 recessively suppresses the phenotypes of mutations in unc-54(r293), lin-29(n546), tra-2 and dpy-5. Abnormal male tail. smg-2 homozygotes have slightly abnormal movement.

Phenotypically wildtype XX hermaphrodite at 20C; poor viability and fertility at 25C. Rare XO animals are hermaphrodite due to suppression of amber mutation e2115 and consequent transformation of XO due to tra-2(e2046) gain-of-function. Reference: Hodgkin & Albertson (1995) PMID: 8647390.

Self-fertile intersexual XX animals. Tra-3 masculinized phenotype suppressed by egl-26 mutation. Reference: Hodgkin (1986) PMID: 3770465.

From CB1490, which is a double mutant of him-5 with ali-1. CB4088 has been outcrossed to remove ali-1.

Hermaphrodite at 15C, sterile and gonad-defective at 25C; feminized by smg (NMD) mutations.

Wildtype hermaphrodites segregating wildtype hermaphrodites and tra-1 XX males, which mate with greater efficiency than most tra-1 XX mutants. Reference: Hodgkin (1987) PMID:3428597.

Spontaneous mutation in TR679. Adults slightly Unc, slow and loopy. Larvae more affected, slow moving.

Spontaneous mutation in parental strain TR679. Adults backward coiler, slow forward, slight kinker. Larvae more affected, strong kinkers. Variable penetrance.

Poorly growing, low self-fertility masculinized XX hermaphrodites. Weak allele of tra-2, partly suppressed to self-fertility by smg (NMD) mutation; permits efficient selection of new feminizing mutations. References: Spence et al. (1990) PMID: 2317869. Zarkower et al. (1994) PMID: 7520378.

Paralyzed Unc. This strain carries a tightly linked mutation, che-3(ky1018), that changes Q1107 of che-3 to a stop codon. Reference: Larsch, et al. (2015) Cell Reports.

Unc-32 hermaphrodites segregating Unc hermaphrodites and Unc Tra homozygous XX pseudomales with variable male tails, hermaphroditic gonads and adult yolk production. Class B2 allele (male tail, sterile hermaphrodite gonad) derived by mutation of tra-(gf) allele e1575. Reference: Hodgkin (1987) PMID:3428597.

y1 is a temperature sensitive mutation affecting only XX animals. him-8(e1489) causes X non-disjunction, resulting in many males. Grow at 15C. XX and XXX animals not viable above 15C. After shifting to 25C, surviving population is almost all XO males.

Variable phenotypes, slightly dumpy and/or uncoordinated, especially at 25C. Grows poorly at 15C. Low fertility. sup-33(st389) is a weak amber suppressor; e2017 and e138 are amber mutations. Reference: Kondo K, et al. (1990) J Mol Biol. 1990 Sep 5;215(1):7-19.

eEx24 [tra-3(+) + rol-6(su1006)]. Pick Rollers to maintain. Roller hermaphrodites producing more Rol hermaphrodites and non-Rol hermaphrodites that produce broods of 100% Tra-3 XX pseudomales. Tra-3 mutant rescued by transgenic tra-3(+); useful source of homozygous m+z- tra-3 XX hermaphrodites. Reference: Barnes & Hodgkin (1996) PMID: 8887539.

Hermaphrodites are WT at all stages. Adult males abnormal with swollen distorted bursal anatomy. Male mating efficiency is zero. Natural mutation present in original KR314 isolate. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Unc. See WBPaper00003781 regarding the unc-122 mutation.

Self-fertile hermaprodite or female. Protruding vulva. tra-1(e2272) XX homozygotes are sterile with abnormal gonads; e2272 mutation is partly suppressed by NMD (smg-2(e2008)), hence double mutants are fertile. Reference: Zarkower et al. (1994) PMID: 7520378.

Unable to propagate indefinitely: lines become sterile from F10-F28, with short telomeres and fused chromosomes. Hypersensitive to X-irradiation; weak Him phenotype; strong Him phenotype in later generations resulting from X-A fusions. Cross once or twice, freeze down many F2 mrt-2 plates, and go back to these plates every two months for fresh a mrt-2 line. A BstN1 RFLP makes the mrt-2 mutation easy to track.

let-560(e2658) was a spontaneous mutation in strain DH424. let-560 homozygotes are late embryonic lethal. Strain segregates WT, Vul and dead eggs.

Obligate XO hermaphrodite. Low fertility, segregating many dead XX and nullo-X zygotes. Double mutant combining two null or near-null mutations. Reference: van den Berg MCW, et al. Genetics. 2006 Jun;173(2):677-83. doi: 10.1534/genetics.106.056093. PMID: 16582430.

eEx512 [dpy-31(+) + sur-5p::GFP]. Pick GFP+ to maintain. Lethal dpy-31 mutant rescued by array containing dpy-31(+) 6.5 kb fragment. Reference: Novelli et al. (2004) PMID: 15579684.

eEx541 [bus-8(+) + sur-5p::GFP]. Pick GFP+ to maintain. Nearly inviable, severely dumpy bus-8 mutant rescued by array. Reference: Partridge et al. (2008) PMID: 18395708.

Weak dumpy. Lethal dpy-31 mutation suppressed by dpy-17 mutation. Reference: Novelli et al. (2006) PMID: 16452136.

eEx541 [bus-8(+) + sur-5p::GFP]. Pick GFP+ to maintain. bus-8(e2892) animals are viable on Leucobacter Verde1, unlike most other bus-8 mutants. References: Partridge et al. (2008) PMID: 18395708. Stroud et al (in preparation).

Surface abnormal. Resistant to infection by Microbacterium nematophilum (no tail swelling). Nonsense mutation Q89stop(UAA).

Bus: resistant to M. nematophilum, Leucobacter Verde2; hypersensitive to Leucobacter Verde1. Strong nonsense mutation of bus-12 (Gln123Amber); reference null allele. Reference: Gravato-Nobre et al. (2011) PMID: 20980242.

nbEx146 [glf-1p::glf-1(+) + sur-5p::GFP]. Pick GFP+ animals to maintain. Array rescues glf-1(null) mutant. Reference: Novelli et al. (2009) PMID: 19751718.

Skiddy, bleach-sensitive, Bus (resistant to infection by M. nematophilum), resistant to Leucobacter Verde2 and to Leucobacter Verde1. Missense mutation in Y11D7A.9. Reference: O'Rourke et al (in preparation).

eEx763 [bus-8(exonU2stop) + sur-5p::GFP]. Pick GFP+ to maintain. Lethal bus-8 mutation rescued by bus-8 transgene defective in 5' exons U1 and U2. Reference: Stroud et al (in preparation).

Pick wild-type to maintain. Wild-type hermaphrodites segregate wild-type and dead masculinized embryos. e3026 is nonsense mutation in essential gene Y47D3B.1. Reference: O'Rourke et al (in preparation).

Skiddy, bleach-sensitive, drug-sensitive. Resistant to infection by Leucobacter Verde1 and Leucobacter Verde2. lj22 is a missense mutation (R32C) in bus-8A and might also affect bus-8B (out-of-frame 5'exon U1). Reference: O'Rourke et al (in preparation).

Small, skiddy, slow-growing, bleach-sensitive; resistant to Leucobacter Verde1. Intragenic pseudorevertant of bus-8(lj22), P63L = KLHPGDWW> KLHLGDWW. lj22 is a missense mutation (R32C) in bus-8A and might also affect bus-8B (out-of-frame 5'exon U1). Reference: O'Rourke et al (in preparation).

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. mIs12 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. uIs69 [pCFJ90(myo-2p::mCherry) + unc-119p::sid-1] V. Mapping strain. This strain is homozygous for integrated fluorescence markers on LG I, II, IV and V, all of which are easily and independently scored using a fluorescent dissecting microscope, plus an easily scored visible marker (dpy-17) for LGIII. The good markers on all five autosomes facilitate linkage assignment of unmapped mutations, and enable rapid replacement of chromosomes when outcrossing heavily mutagenized strains such as those from the Million Mutation Project.

Viable, small, slow-growing, bleach-sensitive, resistant to Leucobacter Verde1 and Leucobacter Verde2. Lethality of subs-4(e3048) suppressed by bus-22(e3108) mutation. Reference: O'Rourke et al (in preparation).

eEx849 [C28H8.4(sdmV186E)]. unc-17 missense mutant suppressed by missense C28H8.4 transgene. Pick non-Unc hermaphrodites to maintain. Animals that have lost the array are severely Unc (coilers). Reference: Stroud et al (in preparation).

eEx855 [erd-2(sdmV186E) + sur-5p::GFP]. unc-17 missense mutant partly suppressed by missense erd-2 (a.k.a. sup-2) transgene. Pick GFP+ (weak Unc) hermaphrodites to maintain. Animals that have lost the array are severely Unc (coilers). Reference: Stroud et al (in preparation).

eEx861 [bus-8(U1,2)::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. bus-8 exon U1 mutation rescued by small U1,2 transgene. lj22 is a missense mutation (R32C) in bus-8A and might also affect bus-8B (out-of-frame 5'exon U1). Reference: O'Rourke et al (in preparation).

Him. Resistant to fungal toxin CGL2; weakly resistant to Leucobacter Verde1. Him strain derived from pmk-1;galt-1 double mutant. References: Butschi et al (2010). O'Rourke et al (in preparation).

Srf, Bus, Bah. Amber nonsense mutation: W125* (TIPFFCKW>TIPFFCK*). Reference: O'Rourke et al (in preparation).

Dominant, gain-of-function mutation in egl-30; missense M244I. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Gln to Stop mutation in residue 205. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Missense mutation E158K. Worms are Egl-c, Eat, and loopy-Unc. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Partial loss of function allele. prp-8(cer22[R2303G]) point mutation mimics a mutation identified in a Retinitis Pigmentosa patient. Slow growth (Gro). Reference: Kukhtar D, et al. Hum Mol Genet. 2020 Mar 27;29(5):756-765. doi: 10.1093/hmg/ddz315. PMID: 31919495

Partial loss of function allele. snrp-200(cer24[S1080L]) point mutation mimics a mutation identified in a Retinitis Pigmentosa patient. Slow growth (Gro). Reference: Kukhtar D, et al. Hum Mol Genet. 2020 Mar 27;29(5):756-765. doi: 10.1093/hmg/ddz315. PMID: 31919495

Superficially wild-type. ubh-4(cer25[F73V]) is a missense mutation mimicking a human BAP1 cancer mutation. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270

Partial loss of function allele. snrp-200(cer23[V676L]) point mutation mimics a mutation identified in a Retinitis Pigmentosa patient. Reduced brood size, slow growth (Gro). Reference: Kukhtar D, et al. Hum Mol Genet. 2020 Mar 27;29(5):756-765. doi: 10.1093/hmg/ddz315. PMID: 31919495

Superficially wild-type. ubh-4(cer32[A87D]) is a missense mutation mimicking a human BAP1 cancer mutation. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270

Missense mutation selenocysteine to cysteine. Resistant to cisplatin exposure. Primers to genotype this missense mutation and other silent mutations: [Common Fw: GGCTTCCACATTCTCACTCC] [RV wildtype: CTTAACCTCAGCAACCAGAA] [RV Sec to Cys: CTTAACCGCAACATCCGCTG] Reference: García-Rodríguez FJ, et al. Dis Model Mech. 2018 Jun 21;11(6).