CER248 |
C. elegans |
snrp-200(cer24[S1080L]) II. Show Description
Partial loss of function allele. snrp-200(cer24[S1080L]) point mutation mimics a mutation identified in a Retinitis Pigmentosa patient. Slow growth (Gro). Reference: Kukhtar D, et al. Hum Mol Genet. 2020 Mar 27;29(5):756-765. doi: 10.1093/hmg/ddz315. PMID: 31919495
|
|
CER256 |
C. elegans |
snrp-200(cer23[V676L]) II. Show Description
Partial loss of function allele. snrp-200(cer23[V676L]) point mutation mimics a mutation identified in a Retinitis Pigmentosa patient. Reduced brood size, slow growth (Gro). Reference: Kukhtar D, et al. Hum Mol Genet. 2020 Mar 27;29(5):756-765. doi: 10.1093/hmg/ddz315. PMID: 31919495
|
|
RG3234 |
C. elegans |
snrp-200(ve734[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval lethal. Deletion of 9661 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead larvae (ve734 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ttgaaaagaataataataataatacaaata ; Right flanking sequence: aggttaaaaaaatcaaaacaagaaataaaa. sgRNA #3: gaccagggagtgggtgacgg; sgRNA #4: GAATCCAGCAGTATGAGTAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
SZ305 |
C. elegans |
unc-73(e936) I; snrp-200(az123) II. Show Description
az123 is an N18K missense allele altering 5' cryptic splicing usage. az123 is a CRISPR-induced mutation mimicking a known suppressor of unc-73(e936). Reference: Cartwright-Acar CH, et al. Nucleic Acids Res. 2022 Nov 11;50(20):11834-11857. doi: 10.1093/nar/gkac991. PMID: 36321655.
|
|