| ZT56 |
C. elegans |
fjSi19 II; unc-119(ed3) III. Show Description
fjSi19 [rpl-21p::2×HA::C04F12.1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The 2×HA::C04F12.1 transgene was designed to express a protein with a double HA tag at its N-terminus, using a strong ubiquitous promoter (rpl-21p). The linker sequence between the two HA tags has a NotI site. The insertion can be checked by PCR with the following primers: GGAGCCGATTTGTTCCAGTC (at the 3'-side of C04F12.1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
|
|
| ZT57 |
C. elegans |
csr-1(fj126) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj126) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. fj126 was generated by the insertion of a synthetic nuclear export signal (NES). Instead of six amino-acid residues (R8I13) near the N-terminus of CSR-1b, an NES sequence (LNELALKLAGLDI) from the cAMP-dependent protein kinase inhibitor alpha in mammals was inserted into the endogenous csr-1 gene. The DNA sequence encoding the NES has a HindIII site. The fj126 mutation can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and CCGCTGAGGAACGAGATGG, followed by digestion with HindIII. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
|
|
| ZT58 |
C. elegans |
fjDf1 fjDf2 fjDf3 fjDf4 X. Show Description
CeRep55 quadruple deletion: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, AGTAGTTACAAAGCGATATACGAAC and TTCGCCGACTCATAGACATCTG; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
|
|
| ZT60 |
C. elegans |
csr-1(fj54)/tmC5 [F36H1.3(tmIs1220)] IV. Show Description
Sterile csr-1 allele balanced over tmC5 labelled with Venus. Heterozygotes are wild-type with somewhat dimmer Venus signal and segregate WT Venus(+) heterozygotes, Mec Unc Venus(+) tmC5 homozygotes, and non-Venus csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. Homologous pairing and unpaired silencing of meiotic chromosomes are inaccurate in this csr-1 null-mutant homozygotes. The fj54 deletion causes a frame-shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA. The inversion-based balancer in ZT60 is more amenable to producing csr-1(fj54) homozygous males than a translocation-based balancer (ZT3). Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
|
|
| ZT61 |
C. elegans |
vsra-1(tm1637) I; csr-1(fj54)/tmC5 [F36H1.3(tmIs1220)] IV. Show Description
Sterile csr-1 allele balanced over tmC5 labelled with Venus. Heterozygotes are wild-type with somewhat dimmer Venus signal and segregate WT Venus(+) heterozygotes, Mec Unc Venus(+) tmC5 homozygotes, and non-Venus csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. Homologous pairing and unpaired silencing of meiotic chromosomes are inaccurate in homozygous tm1637; fj54 double mutants. The vsra-1 mutation enhances the defects caused by the csr-1 mutation. The fj54 deletion causes a frame-shift to stop the translation of both PAZ and Piwi domains. tm1637 can be detected by PCR with the following primers: AAGCAGTTCTTCAAGACTGGTC and TTGTCCACTCGCACTTTGTG. The fj54 deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA. vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
|
|
| ZT63 |
C. elegans |
csr-1(fj150) IV. Show Description
RNAi deficient (Rde). Him. Partially-inaccurate paring of meiotic chromosomes. fj150 is a mutation changing WK to FS and generating a new FspI site in the second K-rich region between the PAZ and Piwi domains. The fj150 mutation can be detected by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC, followed by digestion with FspI. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
|
|
| ZT64 |
C. elegans |
csr-1(fj150) IV; fjDf1 fjDf2 fjDf3 fjDf4 X. Show Description
fj150 is a mutation changing WK to FS and generating a new FspI site in the second K-rich region between the PAZ and Piwi domains. fj150 is enhanced by the CeRep55 quadruple deletion. The fj150 mutation can be detected by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC, followed by digestion with FspI. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, AGTAGTTACAAAGCGATATACGAAC and TTCGCCGACTCATAGACATCTG; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
|
|
| ZT65 |
C. elegans |
him-1(e879) I; fjDf1 fjDf2 fjDf3 fjDf4 X. Show Description
The CeRep55_X quadruple-deletion mutant does not exhibit a clear Him phenotype, but the Him phenotype of the him-1(e879) mutant is enhanced by the CeRep55_X quadruple deletions. CeRep55 quadruple deletion: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, AGTAGTTACAAAGCGATATACGAAC and TTCGCCGACTCATAGACATCTG; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. The e879 mutation can be checked by PCR with the following primers: AAATCAGGAGTGGGCATCAG and GGGAAGATTCCGATGAGTGA, followed by digestion with MvaI. The wild-type him-1 gene contains an MvaI site within its PCR region, while the e879 allele does not. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
|
|
| ZT69 |
C. elegans |
csr-1(fj162) IV; fjDf1 fjDf2 fjDf3 fjDf4 X. Show Description
fj162 at the second K-rich region is an in-frame duplication (comprising of a small duplication and a tiny inverted duplication) generating 61 extra amino acids. The CeRep55_X quadruple-deletion mutant does not exhibit a clear Him phenotype, but the Him phenotype of the csr-1(fj162) mutant is enhanced by the CeRep55_X quadruple deletions. The fj162 mutation can be checked by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, AGTAGTTACAAAGCGATATACGAAC and TTCGCCGACTCATAGACATCTG; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
|
|
| ZT72 |
C. elegans |
dpy-5(e61) I; fjDf1 fjDf2 fjDf3 fjDf4 X. Show Description
This strain carries a dpy-5 mutation to facilitate genome modification in CeRep55 quadruple deletion background: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, AGTAGTTACAAAGCGATATACGAAC and TTCGCCGACTCATAGACATCTG; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
|
|
| ZT73 |
C. elegans |
coh-4(tm1857) coh-3(gk112)/tmC16 [unc-60(tmIs1210)] coh-3(gk112) V. Show Description
Pick wild-type Venus+ animals to maintain. coh-4(tm1857) coh-3(gk112) homozygotes exhibit defects in synaptonemal complex formation on meiotic chromosomes. Many of the progeny from coh-4 coh-3 homozygotes exhibit embryonic lethality, likely due to aneuploidy, but only a few progeny hatch and exhibit the Him phenotype. The coh-3 and coh-4 genes encode nearly identical meiosis-specific kleisins. The deletion mutations can be checked by PCR with the following primers: coh-4(tm1857): TACGCGGCACACATGGGTCT and CAATTCCCCCTAGACATACGATTC; coh-3(gk112): CTCGCAGCGATCGAGCAAGC and AACTGAACATGAGAGCCACGAAG. tmC16 homozygotes are Unc Venus(+). [NOTE: ZT73 with the inversion-based balancer is more amenable to producing coh-4 coh-3 homozygous mutant males than TY5120 with a translocation-based balancer.] Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
|
|
| AA699 |
C. elegans |
din-1(hd36) II. Show Description
non-Daf. Temperature-sensitive phenotypes: at 20C half of the animals are egg-laying defective with occasional mispositioned gonadal arms; at 25C, 18% arrest as embryos: those animals that hatch usually display variable morphology defects in body and pharynx; nearly all animals that live to adults are small, clear, slightly uncoordinated, constipated, and virtually sterile. Maintain at 20C or below.
|
|
| AA790 |
C. elegans |
lin-15B&lin-15A(n765) X; dhEx343. Show Description
dhEx343 [din-1p::din-1E::GFP + lin-15(+)]. Pick GFP+ to maintain. Animals with the array are GFP+ and non-Muv. Animals which have lost the array are Muv and non-GFP. din-1s::GFP is detected in hypodermis, seam, intestine, and somatic gonad including the distal tip cells. din-1s is also expressed in neurons, vulval precursors, body wall muscle, pharynx, and all tissues with heterochronic phenotypes or remodeled during dauer. Expression is first detected in a few nuclei by the comma stage of embryogenesis. By hatching, din-1s was widely expressed, albeit weakly. Overall expression in most tissues is detected at various levels into adult and in dauer larvae. Animals with the array are GFP+ and non-Muv. Animals which have lost the array are Muv and non-GFP. din-1p::din-1E::GFP was produced by cloning into Fire Lab vector L3781.
|
|
| ABR156 |
C. briggsae |
Cbr-she-1(v35) IV; mfIs42. Show Description
mfIs42 [Cel-sid-2(+) + Cel-myo-2::dsRed]. Maintain at 15C. Feminization is partially-penetrant at 15C; most hermaphrodites are somewhat self-fertile and can lay small broods. Can be maintained by crossing with male siblings. Feminized C. briggsae strain made susceptible to RNAi knock-down by feeding dsRNA due to the transgenic expression of C. elegans SID-2. Generated by crossing parental strains JU1018 with RE665. Reference: Booth LN, eLife 2019 Jul 8;8:e46418. PMID: 31282863.
|
|
| AFS205 |
C. elegans |
zen-4(cle5) IV. Show Description
Temperature-sensitive embryonic-lethal mutant. Maintain at 15C. Shift L4s to 25C overnight to observe mutant phenotype of embryos produced by adults. Mutants lack a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). This strain can be used for CRISPR-Cas9 co-conversion. There is a causal mis-sense mutation present in zen-4(cle5), GAC to AAC (D520N), and one silent mutation, GCA to GCT at codon 519, that introduces an AluI site for RFLP analysis. A previous deposited version of this strain, zen-4(ok153), possessed two mis-sense mutations: GAC to AAC (D520N) and GAT to AAT (D735N). Reference: Farboud B, et al. Genetics Early online November 30, 2018; https://doi.org/10.1534/genetics.118.301775.
|
|
| AFS222 |
C. elegans |
zen-4(cle10) IV. Show Description
Temperature-sensitive embryonic-lethal mutant. Maintain at 15C. Shift L4s to 25C overnight to observe mutant phenotype of embryos produced by adults. Mutants lack a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). This strain can be used for CRISPR-Cas9 co-conversion. There is a causal mis-sense mutation present in zen-4(cle10), GAC to AAC (D520N), and two silent mutations. One silent mutation is a CGA to CGG mutation at codon 523 that creates a recognition site for a Cas9 guide RNA, in order to use zen-4(cle10ts) as a CRISPR/Cas9 co-conversion marker. The other silent mutation is a GCA to GCT mutation at codon 519 that introduces an AluI site for RFLP analysis. Reference: Farboud B, et al. Genetics Early online November 30, 2018; https://doi.org/10.1534/genetics.118.301775.
|
|
| AGD1032 |
C. elegans |
glp-1(e2141) III; xzEx1. Show Description
xzEx1 [unc-54p::Dendra2]. Maintain at 15C; sterile at 25C. Pick animals with green fluorescence in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.
|
|
| AGD1033 |
C. elegans |
glp-1(e2141) III; xzEx3. Show Description
xzEx3 [unc-54p::UbG76V::Dendra2]. Maintain at 15C; sterile at 25C. Pick animals with green fluorescence in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.
|
|
| AGD597 |
C. elegans |
uthEx556. Show Description
uthEx556 [sur-5p::rpn-6 + myo-3p::GFP]. Pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.
|
|
| AGD598 |
C. elegans |
uthEx557. Show Description
uthEx557 [sur-5p::rpn-6 + myo-3p::GFP]. Pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.
|
|
| AGD614 |
C. elegans |
uthEx633. Show Description
uthEx633 [myo-3p::GFP]. Pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.
|
|
| AGD850 |
C. elegans |
rmIs110; uthEx557. Show Description
rmIs110 [F25B3.3p::Q40::YFP]. uthEx557 [sur5p::rpn-6 + myo3p::GFP]. All animals will express YFP in nervous system; pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.
|
|
| AGD851 |
C. elegans |
rmIs284; uthEx557. Show Description
rmIs284 [F25B3.3p::Q67::YFP]. uthEx557 [sur-5p::rpn-6 + myo-3p::GFP]. All animals will express YFP in nervous system; pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.
|
|
| AGD866 |
C. elegans |
rmIs110; uthEx633. Show Description
rmIs110 [F25B3.3p::Q40::YFP]. uthEx633 [myo-3p::GFP]. All animals will express YFP in nervous system; pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.
|
|
| AGD867 |
C. elegans |
rmIs284; uthEx633. Show Description
rmIs284 [F25B3.3p::Q67::YFP]. uthEx633 [myo-3p::GFP]. All animals will express YFP in nervous system; pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.
|
|
| AGD885 |
C. elegans |
rrf-3(b26) II; fem-1(hc17) IV; uthEx633. Show Description
uthEx633 [myo-3p::GFP]. Maintain at 15C; sterile at 25C. Pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.
|
|
| AGD886 |
C. elegans |
rrf-3(b26) II; fem-1(hc17) IV; uthEx557. Show Description
uthEx557 [sur-5p::rpn-6 + myo-3p::GFP]. Maintain at 15C; sterile at 25C. Pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.
|
|
| AGK192 |
C. elegans |
unc-119(ed3) III; zdIs13 IV; armIs5. Show Description
zdIs13 [tph-1p::GFP] IV. armIs5 [zfp-1(fosmid)::FLAG + unc-119(+)]. Integrated zfp-1 transgene expressed in the germline. Fosmid-based zfp-1::FLAG transgene fully rescues stress-sensitivity and reduced lifespan in zfp-1(ok554) homozygotes. ChIP with anti-FLAG antibody detects ZFP-1::FLAG localization to promoters of highly expressed genes. References: Mansisidor AR, et al. PLoS Genet. 2011 Sep;7(9):e1002299. Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015. Cecere G, et al. Mol Cell. 2013 Jun 27;50(6):894-907.
|
|
| AGK233 |
C. elegans |
unc-119(ed3) III; niDf199 IV; armEx58. Show Description
armEx58 [WRM0611aH08-Del8mer + unc-119(+)]. Pick non-Unc to maintain. This strain contains a transgenic array that expresses a derivative WRM0611aH08 fosmid. The WRM0611aH08 fosmid contains the niDF199 locus (around 4 kb) that is deleted in the natural C. elegans isolate strain JU258. JU258 worms lack specific 21U-RNAs normally present in N2 worms due to this deletion of the niDF199 locus. This derivative fosmid construct lacks the upstream 8-mer motif (CTGTTTCA) next to 21U-3372. The expression of this individual 21U-RNA is lost in transgenic animals. unc-119(ed3) was crossed into JU258, the niDf199IV deletion was confirmed by PCR, and these Unc worms were used for bombardment. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45.
|
|
| AGK234 |
C. elegans |
unc-119(ed3) III; niDf199 IV; armEx53. Show Description
armEx53 [WRM0611aH08 + unc-119(+)]. Pick non-Unc to maintain. unc-119(ed3) was crossed into JU258, the niDf199IV deletion was confirmed by PCR, and these Unc worms were used for bombardment. This strain contains a transgenic array that expresses the WRM0611aH08 fosmid construct. This fosmid contains the niDF199 locus (around 4 kb) that is deleted in the natural C. elegans isolate strain JU258. JU258 worms lack specific 21U-RNAs normally present in N2 worms due to this deletion of the niDF199 locus. Expression of this fosmid construct in JU258 worms restores the expression of the missing 21U-RNAs in the germline, as measured by RT-qPCR. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45.
|
|
| AGK532 |
C. elegans |
unc-119(ed3) III; niDf199 IV; armEx196. Show Description
armEx196 [mex-5p::unc-130::GFP::tbb-2 3'UTR + Cbr-unc-119(+)]. Pick non-Unc to maintain. unc-119(ed3) was crossed into JU258, the niDf199IV deletion was confirmed by PCR, and these Unc worms were used for bombardment. JU258 worms lack specific 21U-RNAs normally present in N2 worms due to deletion of the niDF199 locus. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45.
|
|
| AH1747 |
C. elegans |
unc-119(ed3) III; zhIs35 I. Show Description
zhIs35 [let-23::GFP + unc-119(+)] I. zhIs35 resuces let-23(sy1) and recapitulates LET-23 antibody staining in VPCs. let-23::GFP transgene expression is higher in this strain than in AH1779 unc-119(ed3) III; zhIs38. Reference: Haag A, et al. PLoS Genet. 2014 May 1;10(5):e1004341.
|
|
| AH1779 |
C. elegans |
unc-119(ed3) III; zhIs38 IV. Show Description
zhIs38 [let-23::GFP + unc-119(+)] IV. zhIs38 resuces let-23(sy1) and recapitulates LET-23 antibody staining in VPCs. let-23::GFP transgene is expressed at levels similar to endogenous LET-23. Reference: Haag A, et al. PLoS Genet. 2014 May 1;10(5):e1004341.
|
|
| ALF4 |
C. elegans |
unc-119(ed3) III; daf-12(rh61rh411) X; bafIs4. Show Description
bafIs4 [daf-12 (fosmid) + unc-119(+)]; rescues both daf-12 and unc-119. Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179.
|
|
| ALF9 |
C. elegans |
unc-119(ed3) III; daf-12(rh61rh411) X; bafIs9. Show Description
bafIs9 [daf-12::TAP (fosmid) + unc-119(+)]; rescues both daf-12 and unc-119. TAP tag inserted into daf-12 fosmid. Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179.
|
|
| AM1246 |
C. elegans |
rmIs126 X. Show Description
rmIs126 [unc-54p::Q0::YFP]. Diffuse distribution of Q0::YFP throughout the body-wall muscle cells. Worms maintain a soluble phenotype for the duration of their lifespan. [NOTE: This strain is a replacement for AM134, which was removed from distribution due to reports that it did not carry the correct transgene.]
|
|
| AM138 |
C. elegans |
rmIs130 II. Show Description
rmIs130 [unc-54p::Q24::YFP]. Diffuse distribution of Q24::YFP throughout the body-wall muscle cells.
|
|
| AM141 |
C. elegans |
rmIs133. Show Description
rmIs133 [unc-54p::Q40::YFP]. AM141 animals show a soluble Q40::YFP distribution in body wall muscle cells immediately after hatching. As these worms age the rapid formation of foci is observed. When they reach adulthood, AM141 animals show an entirely Q40::YFP aggregated phenotype.
|
|
| AM263 |
C. elegans |
rmIs175. Show Description
rmIs175 [unc-54p::Hsa-sod-1 (WT)::YFP]. Array encodes wild-type human SOD-1. YFP expression in body wall muscle. Array is prone to silencing; maintain by picking worms displaying typical aggregation patterns. Reference: Gidalevitz T, et al., PLoS Genet. 2009 Mar;5(3):e1000399.
|
|
| AM725 |
C. elegans |
rmIs290. Show Description
rmIs290 [unc-54p::Hsa-sod-1 (127X)::YFP]. Array encodes mutated form of human SOD-1. YFP expression in body wall muscle. Array is prone to silencing; maintain by picking worms displaying typical aggregation patterns. Reference: Gidalevitz T, et al., PLoS Genet. 2009 Mar;5(3):e1000399.
|
|
| AMH57 |
C. elegans |
unc-33(mn407); olaEx3013. Show Description
olaEx3013 [ttx-3p:mCherry::eGFP::lgg-1 + unc-122p::mCherry]. Pick animals with mCherry+ coelomocytes to maintain array. Unc. Tandem tags on LGG-1 label immature autophagosomes with both GFP and mCherry, but because GFP is preferentially quenched in an acidic environment, mature structures lose their GFP signal and display solely mCherry signal. Reference: Hill SE & Colon-Ramos D. 2018 bioRxiv 287144; doi: https://doi.org/10.1101/287144
|
|
| AMH59 |
C. elegans |
unc-33(e204); olaEx3013. Show Description
olaEx3013 [ttx-3p:mCherry::eGFP::lgg-1 + unc-122p::mCherry]. Pick animals with mCherry+ coelomocytes to maintain array. Paralyzed Unc. Tandem tags on LGG-1 label immature autophagosomes with both GFP and mCherry, but because GFP is preferentially quenched in an acidic environment, mature structures lose their GFP signal and display solely mCherry signal. Reference: Hill SE & Colon-Ramos D. 2018 bioRxiv 287144; doi: https://doi.org/10.1101/287144
|
|
| AMH91 |
C. elegans |
unc-104(e1265) II; olaEx3013. Show Description
olaEx3013 [ttx-3p::mCherry::eGFP::lgg-1 + unc-122p::mCherry]. Pick animals with mCherry+ coelomocytes to maintain array. Unc. Slow moving. Tandem tags on LGG-1 label immature autophagosomes with both GFP and mCherry, but because GFP is preferentially quenched in an acidic environment, mature structures lose their GFP signal and display solely mCherry signal. Reference: Hill SE & Colon-Ramos D. 2018 bioRxiv 287144; doi: https://doi.org/10.1101/287144
|
|
| AMJ565 |
C. elegans |
jamSi6 II; rde-4(ne301) III. Show Description
jamSi6 [nas-9p::rde-4(+)::rde-4 3' UTR + unc-119(+)] II. Enables RNAi silencing in body wall muscles in an otherwise rde-4(ne301) background. jamSi6 was integrated into ttTi5605 II in an EG4322 background using MosSCI. Unknown if unc-119(ed9) is still present or homozygous in background. An isolated inserted line was crossed into AMJ8 (juIs73 [unc-25p::GFP] III) to temporarily balance the endogenous rde-4 locus during the subsequent cross; resulting jamSi6 heterozygous males were crossed into WM49 (rde-4(ne301) III). rde-4(ne301) presumed to be homozygous in this strain due to crossing strategy and minimal recombination between rde-3 and juIs73. Reference: Raman P, et al. Nucleic Acids Res. 2017 Aug 21;45(14):8463-8473. doi: 10.1093/nar/gkx484. PMID: 28541563.
|
|
| AMJ912 |
C. elegans |
jamSi28 II; rde-4(ne301) III. Show Description
jamSi28 [myo-3p::rde-4(+)::rde-4 3' UTR + unc-119(+)] II. Enables RNAi silencing in body wall muscles in an otherwise rde-4(ne301) background. jamSi28 was integrated into ttTi5605 II in an EG4322 background using MosSCI. Unknown if unc-119(ed9) is still present or homozygous in background. An isolated inserted line was crossed into AMJ8 (juIs73 [unc-25p::GFP] III) to temporarily balance the endogenous rde-4 locus during the subsequent cross; resulting jamSi28 heterozygous males were crossed into WM49 (rde-4(ne301) III). rde-4(ne301) presumed to be homozygous in this strain due to crossing strategy and minimal recombination between rde-3 and juIs73. Reference: Raman P, et al. Nucleic Acids Res. 2017 Aug 21;45(14):8463-8473. doi: 10.1093/nar/gkx484. PMID: 28541563.
|
|
| AML105 |
C. elegans |
wtfIs32. Show Description
wtfIs32 [str-2p::ChR2(H134R)::GFP +, myo-3p:mCherry]. Expression of an activating opsin molecule ChR2 (H134R) in AWC-ON neuron and mCherry in body wall muscles. Reference: Chen KS, et al. Olfactory learning alters navigation strategies and behavioral variability in C. elegans. ArXiv, Feb 23:arXiv:2311.07117v2. PMID: 38013890.
|
|
| AML470 |
C. elegans |
juSi164 unc-119(ed3) III; wtfIs458. Show Description
juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfIs458 [mec-4::Chrimson4.2::SL2::mCherry::unc-54 3' UTR + unc-122::GFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Upon blue light treatment (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), Histone-miniSOG in the germline can induce heritable mutations. Transgenic animals express light-gated ion channel Chrimson and a fluorescent protein mCherry in mechanosensory neurons alongside GFP in coelomocytes. Reference: Liu M, et al. PLoS Biol. 2022 Jan 28;20(1):e3001524. doi: 10.1371/journal.pbio.3001524. PMID: 35089912.
|
|
| ANA65 |
C. elegans |
adeIs1 II; unc-119(ed3) III. Show Description
adeIs1 [mex-5::spd-1::GFP + unc-119(+)] II. The transgene has been inserted on chromosome II, using the MosSCI technique. This strains expresses the SPD-1 protein fused to GFP in the germline (both males and females) and in embryos. SPD-1 is nucleolar in interphase and labels the central spindle in mitosis and meiosis, later accumulating at the midbody. Reference: Nahaboo W, et al. Mol Biol Cell. 2015 Jun 1;26(11):2020-9. doi: 10.1091/mbc.E14-12-1577.
|
|
| ANA72 |
C. elegans |
adeIs1 II; unc-119(ed3) III; ltIs37 IV. Show Description
adeIs1 [mex-5::spd-1::GFP + unc-119(+)] II. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Superficially wild-type. SPD-1::GFP and mCherry-tagged histones allow visualisation of chromatin with central spindle/midbody during cell divisions. Reference: Nahaboo W, et al. Mol Biol Cell. 2015 Jun 1;26(11):2020-9.
|
|
| ANR149 |
C. elegans |
rrf-1(pk1417) I; pkIs2386. Show Description
pkIs2386 [unc-54p::alphasynuclein::YFP + unc-119(+)]. YFP expression in the muscles. Derived by crossing parental strains NL5901 and MAH23 to produce a Parkinson's model with germline-only RNAi. unc-119 might still be present in the background, but likely lost during crossing. Reference: Snow S, et al. (2024). Neuronal CBP-1 is required for enhanced body muscle proteostasis in response to reduced translation downstream of mTOR. Frontiers in Bioscience-Landmark.
|
|