Search Strains

Pick wild-type Venus+ animals to maintain. coh-4(tm1857) coh-3(gk112) homozygotes exhibit defects in synaptonemal complex formation on meiotic chromosomes. Many of the progeny from coh-4 coh-3 homozygotes exhibit embryonic lethality, likely due to aneuploidy, but only a few progeny hatch and exhibit the Him phenotype. The coh-3 and coh-4 genes encode nearly identical meiosis-specific kleisins. The deletion mutations can be checked by PCR with the following primers: coh-4(tm1857): TACGCGGCACACATGGGTCT and CAATTCCCCCTAGACATACGATTC; coh-3(gk112): CTCGCAGCGATCGAGCAAGC and AACTGAACATGAGAGCCACGAAG. tmC16 homozygotes are Unc Venus(+). [NOTE: ZT73 with the inversion-based balancer is more amenable to producing coh-4 coh-3 homozygous mutant males than TY5120 with a translocation-based balancer.] Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

non-Daf. Temperature-sensitive phenotypes: at 20C half of the animals are egg-laying defective with occasional mispositioned gonadal arms; at 25C, 18% arrest as embryos: those animals that hatch usually display variable morphology defects in body and pharynx; nearly all animals that live to adults are small, clear, slightly uncoordinated, constipated, and virtually sterile. Maintain at 20C or below.

dhEx343 [din-1p::din-1E::GFP + lin-15(+)]. Pick GFP+ to maintain. Animals with the array are GFP+ and non-Muv. Animals which have lost the array are Muv and non-GFP. din-1s::GFP is detected in hypodermis, seam, intestine, and somatic gonad including the distal tip cells. din-1s is also expressed in neurons, vulval precursors, body wall muscle, pharynx, and all tissues with heterochronic phenotypes or remodeled during dauer. Expression is first detected in a few nuclei by the comma stage of embryogenesis. By hatching, din-1s was widely expressed, albeit weakly. Overall expression in most tissues is detected at various levels into adult and in dauer larvae. Animals with the array are GFP+ and non-Muv. Animals which have lost the array are Muv and non-GFP. din-1p::din-1E::GFP was produced by cloning into Fire Lab vector L3781.

mfIs42 [Cel-sid-2(+) + Cel-myo-2::dsRed]. Maintain at 15C. Feminization is partially-penetrant at 15C; most hermaphrodites are somewhat self-fertile and can lay small broods. Can be maintained by crossing with male siblings. Feminized C. briggsae strain made susceptible to RNAi knock-down by feeding dsRNA due to the transgenic expression of C. elegans SID-2. Generated by crossing parental strains JU1018 with RE665. Reference: Booth LN, eLife 2019 Jul 8;8:e46418. PMID: 31282863.

Temperature-sensitive embryonic-lethal mutant. Maintain at 15C. Shift L4s to 25C overnight to observe mutant phenotype of embryos produced by adults. Mutants lack a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). This strain can be used for CRISPR-Cas9 co-conversion. There is a causal mis-sense mutation present in zen-4(cle5), GAC to AAC (D520N), and one silent mutation, GCA to GCT at codon 519, that introduces an AluI site for RFLP analysis. A previous deposited version of this strain, zen-4(ok153), possessed two mis-sense mutations: GAC to AAC (D520N) and GAT to AAT (D735N). Reference: Farboud B, et al. Genetics Early online November 30, 2018; https://doi.org/10.1534/genetics.118.301775.

Temperature-sensitive embryonic-lethal mutant. Maintain at 15C. Shift L4s to 25C overnight to observe mutant phenotype of embryos produced by adults. Mutants lack a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). This strain can be used for CRISPR-Cas9 co-conversion. There is a causal mis-sense mutation present in zen-4(cle10), GAC to AAC (D520N), and two silent mutations. One silent mutation is a CGA to CGG mutation at codon 523 that creates a recognition site for a Cas9 guide RNA, in order to use zen-4(cle10ts) as a CRISPR/Cas9 co-conversion marker. The other silent mutation is a GCA to GCT mutation at codon 519 that introduces an AluI site for RFLP analysis. Reference: Farboud B, et al. Genetics Early online November 30, 2018; https://doi.org/10.1534/genetics.118.301775.

xzEx1 [unc-54p::Dendra2]. Maintain at 15C; sterile at 25C. Pick animals with green fluorescence in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.

xzEx3 [unc-54p::UbG76V::Dendra2]. Maintain at 15C; sterile at 25C. Pick animals with green fluorescence in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.

uthEx556 [sur-5p::rpn-6 + myo-3p::GFP]. Pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.

uthEx557 [sur-5p::rpn-6 + myo-3p::GFP]. Pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.

uthEx633 [myo-3p::GFP]. Pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.

rmIs110 [F25B3.3p::Q40::YFP]. uthEx557 [sur5p::rpn-6 + myo3p::GFP]. All animals will express YFP in nervous system; pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.

rmIs284 [F25B3.3p::Q67::YFP]. uthEx557 [sur-5p::rpn-6 + myo-3p::GFP]. All animals will express YFP in nervous system; pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.

rmIs110 [F25B3.3p::Q40::YFP]. uthEx633 [myo-3p::GFP]. All animals will express YFP in nervous system; pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.

rmIs284 [F25B3.3p::Q67::YFP]. uthEx633 [myo-3p::GFP]. All animals will express YFP in nervous system; pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.

uthEx633 [myo-3p::GFP]. Maintain at 15C; sterile at 25C. Pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.

uthEx557 [sur-5p::rpn-6 + myo-3p::GFP]. Maintain at 15C; sterile at 25C. Pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.

zdIs13 [tph-1p::GFP] IV. armIs5 [zfp-1(fosmid)::FLAG + unc-119(+)]. Integrated zfp-1 transgene expressed in the germline. Fosmid-based zfp-1::FLAG transgene fully rescues stress-sensitivity and reduced lifespan in zfp-1(ok554) homozygotes. ChIP with anti-FLAG antibody detects ZFP-1::FLAG localization to promoters of highly expressed genes. References: Mansisidor AR, et al. PLoS Genet. 2011 Sep;7(9):e1002299. Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015. Cecere G, et al. Mol Cell. 2013 Jun 27;50(6):894-907.

armEx58 [WRM0611aH08-Del8mer + unc-119(+)]. Pick non-Unc to maintain. This strain contains a transgenic array that expresses a derivative WRM0611aH08 fosmid. The WRM0611aH08 fosmid contains the niDF199 locus (around 4 kb) that is deleted in the natural C. elegans isolate strain JU258. JU258 worms lack specific 21U-RNAs normally present in N2 worms due to this deletion of the niDF199 locus. This derivative fosmid construct lacks the upstream 8-mer motif (CTGTTTCA) next to 21U-3372. The expression of this individual 21U-RNA is lost in transgenic animals. unc-119(ed3) was crossed into JU258, the niDf199IV deletion was confirmed by PCR, and these Unc worms were used for bombardment. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45.

armEx53 [WRM0611aH08 + unc-119(+)]. Pick non-Unc to maintain. unc-119(ed3) was crossed into JU258, the niDf199IV deletion was confirmed by PCR, and these Unc worms were used for bombardment. This strain contains a transgenic array that expresses the WRM0611aH08 fosmid construct. This fosmid contains the niDF199 locus (around 4 kb) that is deleted in the natural C. elegans isolate strain JU258. JU258 worms lack specific 21U-RNAs normally present in N2 worms due to this deletion of the niDF199 locus. Expression of this fosmid construct in JU258 worms restores the expression of the missing 21U-RNAs in the germline, as measured by RT-qPCR. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45.

armEx196 [mex-5p::unc-130::GFP::tbb-2 3'UTR + Cbr-unc-119(+)]. Pick non-Unc to maintain. unc-119(ed3) was crossed into JU258, the niDf199IV deletion was confirmed by PCR, and these Unc worms were used for bombardment. JU258 worms lack specific 21U-RNAs normally present in N2 worms due to deletion of the niDF199 locus. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45.

zhIs35 [let-23::GFP + unc-119(+)] I. zhIs35 resuces let-23(sy1) and recapitulates LET-23 antibody staining in VPCs. let-23::GFP transgene expression is higher in this strain than in AH1779 unc-119(ed3) III; zhIs38. Reference: Haag A, et al. PLoS Genet. 2014 May 1;10(5):e1004341.

zhIs38 [let-23::GFP + unc-119(+)] IV. zhIs38 resuces let-23(sy1) and recapitulates LET-23 antibody staining in VPCs. let-23::GFP transgene is expressed at levels similar to endogenous LET-23. Reference: Haag A, et al. PLoS Genet. 2014 May 1;10(5):e1004341.

bafIs4 [daf-12 (fosmid) + unc-119(+)]; rescues both daf-12 and unc-119. Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179.

bafIs9 [daf-12::TAP (fosmid) + unc-119(+)]; rescues both daf-12 and unc-119. TAP tag inserted into daf-12 fosmid. Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179.

rmIs126 [unc-54p::Q0::YFP]. Diffuse distribution of Q0::YFP throughout the body-wall muscle cells. Worms maintain a soluble phenotype for the duration of their lifespan. [NOTE: This strain is a replacement for AM134, which was removed from distribution due to reports that it did not carry the correct transgene.]

rmIs130 [unc-54p::Q24::YFP]. Diffuse distribution of Q24::YFP throughout the body-wall muscle cells.

rmIs133 [unc-54p::Q40::YFP]. AM141 animals show a soluble Q40::YFP distribution in body wall muscle cells immediately after hatching. As these worms age the rapid formation of foci is observed. When they reach adulthood, AM141 animals show an entirely Q40::YFP aggregated phenotype.

rmIs175 [unc-54p::Hsa-sod-1 (WT)::YFP]. Array encodes wild-type human SOD-1. YFP expression in body wall muscle. Array is prone to silencing; maintain by picking worms displaying typical aggregation patterns. Reference: Gidalevitz T, et al., PLoS Genet. 2009 Mar;5(3):e1000399.

rmIs290 [unc-54p::Hsa-sod-1 (127X)::YFP]. Array encodes mutated form of human SOD-1. YFP expression in body wall muscle. Array is prone to silencing; maintain by picking worms displaying typical aggregation patterns. Reference: Gidalevitz T, et al., PLoS Genet. 2009 Mar;5(3):e1000399.

olaEx3013 [ttx-3p:mCherry::eGFP::lgg-1 + unc-122p::mCherry]. Pick animals with mCherry+ coelomocytes to maintain array. Unc. Tandem tags on LGG-1 label immature autophagosomes with both GFP and mCherry, but because GFP is preferentially quenched in an acidic environment, mature structures lose their GFP signal and display solely mCherry signal. Reference: Hill SE & Colon-Ramos D. 2018 bioRxiv 287144; doi: https://doi.org/10.1101/287144

olaEx3013 [ttx-3p:mCherry::eGFP::lgg-1 + unc-122p::mCherry]. Pick animals with mCherry+ coelomocytes to maintain array. Paralyzed Unc. Tandem tags on LGG-1 label immature autophagosomes with both GFP and mCherry, but because GFP is preferentially quenched in an acidic environment, mature structures lose their GFP signal and display solely mCherry signal. Reference: Hill SE & Colon-Ramos D. 2018 bioRxiv 287144; doi: https://doi.org/10.1101/287144

olaEx3013 [ttx-3p::mCherry::eGFP::lgg-1 + unc-122p::mCherry]. Pick animals with mCherry+ coelomocytes to maintain array. Unc. Slow moving. Tandem tags on LGG-1 label immature autophagosomes with both GFP and mCherry, but because GFP is preferentially quenched in an acidic environment, mature structures lose their GFP signal and display solely mCherry signal. Reference: Hill SE & Colon-Ramos D. 2018 bioRxiv 287144; doi: https://doi.org/10.1101/287144

jamSi6 [nas-9p::rde-4(+)::rde-4 3' UTR + unc-119(+)] II. Enables RNAi silencing in body wall muscles in an otherwise rde-4(ne301) background. jamSi6 was integrated into ttTi5605 II in an EG4322 background using MosSCI. Unknown if unc-119(ed9) is still present or homozygous in background. An isolated inserted line was crossed into AMJ8 (juIs73 [unc-25p::GFP] III) to temporarily balance the endogenous rde-4 locus during the subsequent cross; resulting jamSi6 heterozygous males were crossed into WM49 (rde-4(ne301) III). rde-4(ne301) presumed to be homozygous in this strain due to crossing strategy and minimal recombination between rde-3 and juIs73. Reference: Raman P, et al. Nucleic Acids Res. 2017 Aug 21;45(14):8463-8473. doi: 10.1093/nar/gkx484. PMID: 28541563.

jamSi28 [myo-3p::rde-4(+)::rde-4 3' UTR + unc-119(+)] II. Enables RNAi silencing in body wall muscles in an otherwise rde-4(ne301) background. jamSi28 was integrated into ttTi5605 II in an EG4322 background using MosSCI. Unknown if unc-119(ed9) is still present or homozygous in background. An isolated inserted line was crossed into AMJ8 (juIs73 [unc-25p::GFP] III) to temporarily balance the endogenous rde-4 locus during the subsequent cross; resulting jamSi28 heterozygous males were crossed into WM49 (rde-4(ne301) III). rde-4(ne301) presumed to be homozygous in this strain due to crossing strategy and minimal recombination between rde-3 and juIs73. Reference: Raman P, et al. Nucleic Acids Res. 2017 Aug 21;45(14):8463-8473. doi: 10.1093/nar/gkx484. PMID: 28541563.

wtfIs32 [str-2p::ChR2(H134R)::GFP +, myo-3p:mCherry]. Expression of an activating opsin molecule ChR2 (H134R) in AWC-ON neuron and mCherry in body wall muscles. Reference: Chen KS, et al. Olfactory learning alters navigation strategies and behavioral variability in C. elegans. ArXiv, Feb 23:arXiv:2311.07117v2. PMID: 38013890.

juSi164 [mex-5p::HIS-72::miniSOG + Cbr-unc-119(+)] III. wtfIs458 [mec-4::Chrimson4.2::SL2::mCherry::unc-54 3' UTR + unc-122::GFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Upon blue light treatment (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), Histone-miniSOG in the germline can induce heritable mutations. Transgenic animals express light-gated ion channel Chrimson and a fluorescent protein mCherry in mechanosensory neurons alongside GFP in coelomocytes. Reference: Liu M, et al. PLoS Biol. 2022 Jan 28;20(1):e3001524. doi: 10.1371/journal.pbio.3001524. PMID: 35089912.

adeIs1 [mex-5::spd-1::GFP + unc-119(+)] II. The transgene has been inserted on chromosome II, using the MosSCI technique. This strains expresses the SPD-1 protein fused to GFP in the germline (both males and females) and in embryos. SPD-1 is nucleolar in interphase and labels the central spindle in mitosis and meiosis, later accumulating at the midbody. Reference: Nahaboo W, et al. Mol Biol Cell. 2015 Jun 1;26(11):2020-9. doi: 10.1091/mbc.E14-12-1577.

adeIs1 [mex-5::spd-1::GFP + unc-119(+)] II. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Superficially wild-type. SPD-1::GFP and mCherry-tagged histones allow visualisation of chromatin with central spindle/midbody during cell divisions. Reference: Nahaboo W, et al. Mol Biol Cell. 2015 Jun 1;26(11):2020-9.

pkIs2386 [unc-54p::alphasynuclein::YFP + unc-119(+)]. YFP expression in the muscles. Derived by crossing parental strains NL5901 and MAH23 to produce a Parkinson's model with germline-only RNAi. unc-119 might still be present in the background, but likely lost during crossing. Reference: Snow S, et al. (2024). Neuronal CBP-1 is required for enhanced body muscle proteostasis in response to reduced translation downstream of mTOR. Frontiers in Bioscience-Landmark.

pkIs2386 [unc-54p::alphasynuclein::YFP + unc-119(+)]. neIs9 [myo-3::HA::rde-1 + rol-6(su1006)] X. Rollers. YFP expression in the muscles. Derived by crossing parental strains NL5901 and WM118 to produce a Parkinson's model with muscle-only RNAi. Reference: Snow S, et al. (2024). Neuronal CBP-1 is required for enhanced body muscle proteostasis in response to reduced translation downstream of mTOR. Frontiers in Bioscience-Landmark.

pkIs2386 [unc-54p::alphasynuclein::YFP + unc-119(+)]. uIs57 [unc-119p::YFP + unc-119p::sid-1 + mec-6p::mec-6]. YFP expression in the muscles. Parkinson's model with hypersensitive neuronal RNAi. Reference: Snow S, et al. (2024). Neuronal CBP-1 is required for enhanced body muscle proteostasis in response to reduced translation downstream of mTOR. Frontiers in Bioscience-Landmark.

ljfSi33 [myo3p::egl-17::mNG::SL2::2x mKate2::PH::3xHA::tbb-2 3'UTR loxN] I. ljfSi10 [hlh-8p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] II. egl-17(ljf14) was generated by replacing the endogenous egl-17 coding sequence with mNG::3xFlag. Sex myoblast migration defects, Egl. EGL-17::mNG expression in body wall muscles. mTurquoise2::PH plasma membrane marker that is expressed in the M lineage. ljfSi33 is a single copy transgene inserted at Chr I:2851088, near ttTi4348. ljfSi10 was inserted at Chr II:8420157-8420243, near ttTi5605, using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.

ljfSi2 [hlh-8p::2x mKate2::D. melanogaster moesin actin-binding domain::SL2::2x mTurquoise2::PH::3xHA::tbb-2 3'UTR loxN] I. ljfSi39 [myo-3p::egl-15(5a)::SL2::2x mKate2::PH::3xHA::tbb-2 3' UTR lox511i] IV. mNeonGreen::3xFlag tag inserted at the C-terminus of the endogenous egl-17. EGL-15(5a) expression in body wall muscle cells captures free EGL-17, reducing long-range signaling and causing moderately penetrant sex myoblast migration defects. ljfSi2 is a single copy transgene inserted at Chr I:2851088 near ttTi4348 using Cas9-triggered homologous recombination. ljfSi39 is a single copy transgene inserted at Chr IV:4237723 using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.

Superficially wild-type. Antibody staining required to observe phenotype. Contains at least one extraneous mutation in the background (Eur. Worm Mtg 2006, Venuz et al.).

kyIs140 [str-2::GFP + lin-15(+)] I. Kinker; can't back up. srf-6 mutants express str-2::GFP in both AWC neurons (2AWC ON phenotype; wild-type phenotype is 1AWC ON): check for this phenotype to avoid reversion of srf-6(yj13). srf-6 mutants were originally identified by binding of an L1-specific antibody in later larval stages (L1-L4).

kyIs140 [str-2::GFP + lin-15(+)] I. nsy-1(ky593) has no visible phenotype, but can be tracked by linked Unc-4 phenotype (Kinker, can't back up). str-2::GFP is expressed in both AWC neurons.

Superficially wild-type. Antibody staining required to observe phenotype.

goeIs3 [myo-3p::SL1::GCamP3.35::SL2::unc-54 3'UTR + unc-119(+)]. aceIs1 [myo-3p::mitochondrial LAR-GECO + myo-2p::RFP]; likely inserted into LG II. Reporter expresses the calcium indicator cytosolic GCaMP3 and mitochondrial LAR-GECO in all body wall muscles.

ccIs4251 [myo-3p::GFP::LacZ::NLS + myo-3p::mitochondrial GFP + dpy-20(+)] I. aceIs1 [myo-3p::mitochondrial LAR-GECO + myo-2p::RFP]; likely inserted into LG II. Reporter expresses the calcium indicator mitochondrial LAR-GECO in all body wall muscles.