Search Strains

gtIs2512 [pie-1p::his-11::GFP + unc-119(+)]. Segregates WT GFP+ heterozygotes, non-GFP mus-81; xpf-1 double homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+ to retain balanced strain: 15-25% of mus-81; xpf-1 double homozygotes are viable. unc-119(ed3) has likely been lost through outcrossing, but could still be present in the background. Reference: Agostinho A, et al. PLos Genetics 2013.

gtIs2512 [pie-1p::his-11::GFP + unc-119(+)]. Segregates WT GFP+ heterozygotes, non-GFP slx-1; xpf-1 double homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+ to retain balanced strain: 15-25% of slx-1; xpf-1 double homozygotes are viable. unc-119(ed3) has likely been lost through outcrossing, but could still be present in the background. Reference: Agostinho A, et al. PLos Genetics 2013.

ddIs151 [mdf-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

Temperature sensitive. Maintain at 15C. See also WBPaper00002184.

Temperature sensitive. Maintain at 15C. See also WBPaper00002184.

zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)]. Daf-c, Rol, Fluorescent DAF-16::GFP, Age, increased resistance to heat and UV. Grows and reproduces slowly. Maintain at 20C. Integrated by gamma irradiation of extrachromosomal (Ex daf-16::GFP) line. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. April 2005: Corrigendum: daf-16 integrates developmental and environmental inputs to mediate aging in the nematode Caenorhabditis elegans. Joshua McElwee of University College London has brought to our attention that plasmid pGP30 described in Henderson and Johnson (Current Biology 11, 1975-1980, December 2001) contains a mutation. We have confirmed the mutation in our own traces from the original sequence. Using daf-16a2 cDNA as a reference sequence (genbank accession number AF020343), pGP30 contains an A to T transversion at AF020343 position 1747:(TTCCCGATCAGCCACTGATGG(a/t)ACTATGGATGTTGATGCATTGA). This mutation results in an GAT (asp) to GTT(val) change at position 484 of the translated AF020343 sequence. The DAF-16::GFP (green fluorescent protein) protein encoded by pGP30 rescues a daf-16 null phenotype and behaves similarly to other reported DAF-16 fusion constructs (Lee et al., 2001; Lin et al., 2001). Therefore, we do not feel it alters the conclusions of the paper. We regret any inconvenience this may have caused. Samuel T. Henderson* and Thomas E. Johnson². ²Correspondence: johnsont@colorado.edu. Lee, R. Y., Hench, J., and Ruvkun, G. (2001). Regulation of C. elegans DAF-16 and its human ortholog FKHRL1 by the daf-2 insulin-like signaling pathway. Curr Biol 11, 1950-1957.Lin, K., Hsin, H., Libina, N., and Kenyon, C. (2001). Regulation of the Caenorhabditis elegans longevity protein DAF-16 by insulin/IGF-1 and germline signaling. Nat Genet 28, 139-145. This strain cannot be used for any commercial purpose or for work on human subjects.

Temperature sensitive sperm defect, grow at 15C. Long life (1.7X N2 is typical). Low brood size (15% of N2 is typical).

Long life (1.7X greater than N2). Low brood size (10% of N2). Temperature sensitive sperm defect; grow at 15C. WT.

Long lived (1.4X CB120). Low brood size. Unc. Temperature sensitive sperm defect. Maintain at 15C.

gpIs1 [hsp-16.2p::GFP]. Inducible GFP fluorescence after >1 hour heat shock at 35C. Temperature sensitive. Maintain at 15C.

High frequency of dauer formation under hyperoxia (90% oxygen) at 20C. Reference: Honda Y, Tanaka M, Honda S, (2008) Exp Gerontol 43:520-9.

Hypersensitive to Paraquat. Growth arrest under hyperoxia (90% oxygen) at any larval stage. Reference: Honda Y, Tanaka M, Honda S, (2008) Exp Gerontol 43:520-9.

Daf-c. Maintain at 15C. Sensitive to hyperoxia and paraquot, comparable to mev-1(kn1) alone. High mutation rate. Extended lifespan measured after mid-adult stage is similar to daf-2(e1370) alone. High mortality rate in early adults. Reference: Honda Y, Tanaka M, Honda S. Exp Gerontol. 2008 Jun;43(6):520-9.

Recessive gain-of-function. Codon 393 changed from alanine (GCT) to threonine (ACT). Deg and Tab at all temperatures. Lethal at 15C (embryos arrest at the two-fold stage, larvae survive).

wyEx9745 [unc-86p::mCherry::PLCdeltaPH + odr-1p::GFP]. Pick GFP+ animals to maintain. zif-1(gk117) is a punitive null allele. mCherry expression in early PVD membrane. Reference: Liang X, et al. Elife. 2020 Jul 13:9:e56547. PMID: 32657271.

tmIs905 [dat-1p::alpha-synuclein(A30P) + ges-1p::DsRed] II. egIs1 [dat-1p::GFP]; reportedly maps to LG IV. hrpr-1 also known as hrp-2. yyz8 is a weak loss-of-function allele. Neurodegeneration in ADE neurons. Neurites are shorter in PDE neurons.

teIs113 [pie-1p::GFP::H2B::zif-13'UTR 771bp + unc-119(+)]. A 771 bp genomic sequence downstream of the zif-1 stop codon (starting immediately after the stop codon) was cloned downstream of pie-1 promoter-driven GFP::H2B in the germline expression vector pID3.01B. Superficially wild-type. Reference: Oldenbroek M, et al. Dev Biol. 2012 Mar 15;363(2):388-98.

Heterozygotes are Unc and segregate Unc and non-Unc steriles (oma-1; oma-2 homozygotes). The Oma animal has an empty uterus and lots of oocytes in the gonad arms. Maintain by picking Uncs. zu405 is a gain-of-function mutation which results in temperature sensitive, embryonic lethality. Loss-of-function mutation in either oma-1 or oma-2 alone does not have a detectable phenotype. te33 is a dominant suppressor of the zu405 embryonic lethality. te51 is a mutation that, in the oma-1(zu405te33) background, gives an Oma (Ooctye Maturation defective) phenotype. [NOTE (09/2016; D. Greenstein, unpublished results): The two molecular changes in te33 are different than reported by Detwiler et al. (2001), but nonetheless result in a strong loss of oma-1 function. Sequencing of the original isolate of te33 gave the same result (S. Robertson and R. Lin, unpublished results).] This strain carrying oma-1(zu405te33) contains the following mutations: zu405 [C8889984T; P240L] and te33 [C8889978A, S238stop & C8889863T, H200Y].

teIs90 [(pRL1483) pie-1p::GFP::taf-4 + unc119(+)]. Sick at high temperatures. Maintain at 20C, but it will silence after some generations.

Animals heterozygous for yDp4 are Dpy non-Flu non-Unc. Animals which have lost yDp4 are FluUnc. Animals homozygous for yDp4 are dead (embryonic lethal). Low percentage of non-Dpy non-Unc progeny. These give a high percentage of Unc male self-progeny and are inferred to be yDp4 XO hermaphrodites.

meDf6; yDp13 is WT hermaphrodite which is Him. 27% of self-progeny are WT males. yDp13 recombines with X, but such recombination is greatly reduced in an meDf6 background. Maintain by picking L4 hermaphrodites and checking to make sure they give lots of dead eggs and lots of males. [yDp13 XO males with an intact X chromosome are >90% inviable.]

meDf6; yDp15 is WT hermaphrodite which is Him. 23% of self-progeny are WT males. yDp15 recombines with X, but such recombination is greatly reduced in an meDf6 background. Maintain strain by picking L4 hermaphrodites and making sure they give lots of dead eggs and lots of males. [yDp15 XO males with an intact X chromosome are >90% inviable.]

Egl. Not temperature sensitive -- can be grown at any temperature.

cuIs2 [myo-2c:: GFP + rol-6(su1006)]. Weak Rollers. Dauer constitutive at higher temperatures. Maintain at 15C.

cuIs5 [myo-2c:: GFP + rol-6(su1006)]. Daf-c. Maintain at 15C. Rollers. GFP+ in pharynx. Reference: Reiner DJ, et al. (2008) Current Biology 18(15):1101-9.

cuIs5 [myo-2c::GFP + rol-6(su1006)]. Rollers. GFP+ in pharynx.

pkEx10 [T14G10 + dpy-20(+)]. Maintain by picking WT.

leEx1447 contains [hif-1::GFP + unc-119(+)]. Trangenic animals are superficially wild-type. Maintain by picking GFP+.

Heterozygotes are GFP+, and segregate non-GFP hermaphrodites which give only dead eggs. sun-1 is also called mtf-1.

svIs69 [daf-28p::daf-28::GFP + unc-4(+)]. Derived from injection of pVB298gk (daf-28p::daf-28::GFP) with unc-4(+) into unc-4(e120). unc-4(e120) was likely removed during out-crossing, but might still be in background.

vbaIs52 [eef-1A.1p::YFP::nrde-3] II. Maintain at 20C or cooler; germline mortal (Mrt) at 25C. YFP::NRDE-3 localizes to the cytoplasm, except in the germline, early embryo, and intestine. Upon introduction of dsRNA, YFP::NRDE-3 labels transcription sites of dsRNA gene targets. Superficially wild-type. Reference: Toudji-Zouaz A, et al. Nucleic Acids Research. 2021 Jun 9;gkab469. doi: 10.1093/nar/gkab469. PMID: 34107044.

vbaIs56 [eef-1A.1p::VenusN::nrde-3] I. vbaIs55 [eef-1A.1p::VenusC::nrde-3] II. Maintain at 20C or cooler; germline mortal (Mrt) at 25C. N-terminal and C-terminal fragments of the fluorescent protein Venus are fused to NRDE-3 to facilitate trimolecular fluorescence complementation. In the cytoplasm or nucleus, local concentration of NRDE-3 molecules does not allow fluorescence complementation, thus reducing background fluorescence; once bound on the target transcript, VenusN::NRDE-3 and VenusC::NRDE-3 are in sufficient proximity to allow for fluorescence complementation, labeling transcription sites of dsRNA gene targets. Superficially wild-type. Reference: Toudji-Zouaz A, et al. Nucleic Acids Research. 2021 Jun 9;gkab469. doi: 10.1093/nar/gkab469. PMID: 34107044.

vbaIs54 [eef-1A.1p::YFP::nrde-3::SL2::sid-1] II. YFP::NRDE-3 localizes to the cytoplasm in most somatic tissues and upon exposure to dsRNA targetting a gene, moves to the nucleus in cells expressing the transgene. Superficially wild-type. Reference: Toudji-Zouaz A, et al. Nucleic Acids Research. 2021 Jun 9;gkab469. doi: 10.1093/nar/gkab469. PMID: 34107044.

C10C5.6a. Homozygous lethal deletion chromosome balanced by translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, vulvaless nT1 homozygotes, and ok1412 homozygotes (arrested incomplete dauers). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK520.1. Superficially wild type. External left primer: CTCGCAATTCCAGACTGACA. External right primer: CGGAGTGAAGTATCCGGTGT. Internal left primer: TCTGCGGATTCTCCATAACC. Internal right primer: GCGGCAGTTCCGTTATATGT. Internal WT amplicon: 1950 bp. Deletion size: 403 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y56A3A.20. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous gk40 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y50E8A.16. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F57A10.3. Superficially wild type. External left primer: AACCGGTTCTTGTCCAACTG. External right primer: CTACACCTCCCTGGCAATGT. Internal left primer: ACGACGCCAATATGATGGAT. Internal right primer: GAACGTCTTTCTTCCGTTCG. Internal WT amplicon: 1973 bp. Deletion size: 1141 bp. Deletion left flank: TTTTTTAATAAGTTTAATCACATTTTTCGG. Deletion right flank: GTAATTTCTCTTTTTTTTTAAAAAGACTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H21P03.1. Superficially wild type. External left primer: CAGGCATCATCCAATGACAG. External right primer: TGCACTTTTCTCCTCTCGGT. Internal left primer: TGCATATCCCAACATTCCAA. Internal right primer: TCTTTGCTAACCGGCTGTCT. Internal WT amplicon: 1923 bp. Deletion size: 1428 bp. Deletion left flank: AATCATGTCACAGTCATGGATTTAAAATGA. Deletion right flank: ACCAGAAAACTCTATTCCAATATAGCAATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K03B4.3, K03B4.2. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1719 homozygotes (scrawny sterile adult with glassy appearance). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGGCAAATTGTGGTTTTTCT. External right primer: GAAAAGTGTGGAACAGGGGA. Internal left primer: CTATTTTCGGGATTTTGGCA. Internal right primer: AACCTCTTGGCCTCCGTAGT. Internal WT amplicon: 2562 bp. Deletion size: 1311 bp. Deletion left flank: CGAAAACGCGCGCCGCACATTGCAAGTGGG. Deletion right flank: ATCGCAACCGTCCCCCGTTCCAAGTGTGGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47G6A.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1690 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGAAATCCCTTCGCACACT. External right primer: ATTGGCATTTTTCTAGCCGA. Internal left primer: GCGAAAAACAACGATTAGCC. Internal right primer: CTGGAACTTGGAAACTTGGG. Internal WT amplicon: 3142 bp. Deletion size: 1258 bp. Deletion left flank: CTACAGGAAGAGGAGAGTGGGCTCATTGAG. Deletion right flank: TTTGCCCATTTTTGCTAAAATTGAACCAAA. Insertion Sequence: CCCATTTTTGCCCATTTTTGCCCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F25H5.4. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1774 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTGGCGCTCTACCGTACTTT. External right primer: AGGCCGAAACAAATTCAATG. Internal left primer: GCAAATTTTGGGCCTACTGA. Internal right primer: AAACGATCTGGTTTGGCTTG. Internal WT amplicon: 2855 bp. Deletion size: 1443 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F48D6.1. External left primer: AACCCAGTTTGGCTTTTGTG. External right primer: ACTAAACTGCGCCGACATCT. Internal left primer: TAATGCAAATGGGAATGCAA. Internal right primer: CGGCAAATTGTTGATCACTG. Internal WT amplicon: 2477 bp. Deletion size: 583 bp. Deletion left flank: GAAGAAGCGTAAGATTTTATAGAAGAAGTA. Deletion right flank: GTGACATAAATGAGGAAGAAGCTAGCAATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F48D6.1. External left primer: AACCCAGTTTGGCTTTTGTG. External right primer: ACTAAACTGCGCCGACATCT. Internal left primer: TAATGCAAATGGGAATGCAA. Internal right primer: CGGCAAATTGTTGATCACTG. Internal WT amplicon: 2477 bp. Deletion size: 794 bp. Deletion left flank: TACCAAGCATTGATTCAACAACATCAGCCG. Deletion right flank: ATATAATCAGATTCTAATGAAAAAAAGTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54H5.4. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk612 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAGTGCGCAATATCCAGAGA. External right primer: TCATCATTGACTTCCCACCA. Internal left primer: CCGAAAGAGAGTGAAGACGG. Internal right primer: TAAGCTGATCGTTGACCGTG. Internal WT amplicon: 1778 bp. Deletion size: 571 bp. Deletion left flank: TTCCTCTCCCGCAATTTGAATTTTTTCTCT. Deletion right flank: CCATCAAAATGGAGATTCCCATGCATCCGT. klf-3 was formerly known as mua-1. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T16G1.11. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W10D5.1. External left primer: CCCTGTTGGATCTCCTGAAA. External right primer: TCATCACACAACACACCACG. Internal left primer: AAGAAGGCAGGCTCGTGTAA. Internal right primer: CCACCTACTCCATACCGCAA. Internal WT amplicon: 1885 bp. Deletion size: 1075 bp. Deletion left flank: TATGAAAAATCATGGTAACCTCCAGAGATT. Deletion right flank: TAATTTTTATCAAAAAATTGTCAGAACATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59B2.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K10D3.3. External left primer: GTCAACTGATATGAGCGGCA. External right primer: CGCGTAATCTTTTTCTTCGC. Internal left primer: GAACATGGCCCTGAAATGAT. Internal right primer: GGCGCTATTCAGCTTTCAAT. Internal WT amplicon: 2230 bp. Deletion size: 1887 bp. Deletion left flank: TGACTGATAATTTTTTAAAAACCCGAATAA. Deletion right flank: GAGAAATCGTTGACGGACAGGGAACTAGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y57G11C.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807