Search Strains

F54F7.1. External left primer: GTCAGCCGAATCAAAAGCTC. External right primer: TTTCCTTCCTCTCCCGATTT. Internal left primer: CCACTCTGTTGCCAATTTGA. Internal right primer: GGACGAAGAGCGTCCAAATA. Internal WT amplicon: 2248 bp. Deletion size: 1772 bp. Deletion left flank: AGTTCATTTGTTTGTTTATTTGTTTCGTTT. Deletion right flank: TACATTAAAATTGAAAATGGGAAACTAAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C07G2.2. External left primer: CAAGAAGGGACGGAAATTCA. External right primer: AATATTTGCAGGTGGTTCGC. Internal left primer: GCTGTGGAGCTCGAAGAGTT. Internal right primer: CCACTGTTTCTCCACCCATT. Internal WT amplicon: 1805 bp. Deletion size: 1197 bp. Deletion left flank: ATTCCTCTAGTATTCCATAAATCTTGACAT. Deletion right flank: AGAAAAACAAACAAAAAGCTTACCTCTGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK520.3. External left primer: GAGGTCGCTCCACTCTCAAC. External right primer: CAGCAGACGCACTCACATTT. Internal left primer: CGGCAATCGCTAGTACATCA. Internal right primer: TCGATGTCGGCTGTGTATTC. Internal WT amplicon: 1671 bp. Deletion size: 202 bp. Deletion left flank: TGCCCATTTGGTCTCCATCGATGAATAATC. Deletion right flank: AAAAAATGAAGTACAAATCATTGAGCTACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F43E2.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C04C3.5. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk760 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACCACCCATCATGTTACCGT. External right primer: GAAGCTCGTCGACCGTAGTC. Internal left primer: TCACGCATCCTTCTTCTCCT. Internal right primer: TTGCAGGGAGTTTCTATGGG. Internal WT amplicon: 1853 bp. Deletion size: 736 bp. Deletion left flank: TACTCGTCCATATACTGAGGTCGGAAGGAC. Deletion right flank: CGGACCTCCTGCATCTGAACTTTCGACAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F23B2.4. External left primer: TGCAATACCCCAAATTGGTT. External right primer: AGTTTGGTTGAGATCGTCCG. Internal left primer: TTATTGACGGTTCCTCGGTC. Internal right primer: GCTGATCGCCCATATCTCAT. Internal WT amplicon: 1963 bp. Deletion size: 834 bp. Deletion left flank: TTAAACTAATATTTGCGGTAAAATATGTAC. Deletion right flank: CCAAAAAAAAAAACTGTTCCCCATGGAAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y92C3B.2. External left primer: ACCGGTTACTGTAGGCATCG. External right primer: TCGGTGATTTTGGTGTGAAA. Internal left primer: AGCGTTATTTGCTGCGATTT. Internal right primer: TCACAGGAGCACATTTGACC. Internal WT amplicon: 1809 bp. Deletion size: 737 bp. Deletion left flank: GTTTTGCCATGAAAAAGTGCAAATTTAGGT. Deletion right flank: TCAATTTTTCGCTCTAAAATCGAATTTCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K01A1.1. External left primer: CTGTGGGATTTGCAGGACTT. External right primer: CCGGATCGATTGCTAGAGAG. Internal left primer: ACAAACATTGACAGGAGCCC. Internal right primer: CCAATTTCTCGGGAATGAAA. Internal WT amplicon: 2095 bp. Deletion size: 655 bp. Deletion left flank: CAGTGAGCAATTCACAACAGTTCTTCAATG. Deletion right flank: ATTAACGCTCCATAACGCTCGTACTTGTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y56A3A.3. External left primer: TAAAGCACAAATCCCGGAAG. External right primer: GTTTGACCGTTGTAGGCGAT. Internal left primer: ATGTGCAGCAGAAAGGGAAG. Internal right primer: TTGTCGAATCACACAGGAGG. Internal WT amplicon: 2124 bp. Deletion size: 1620 bp. Deletion left flank: AAAAAAGAGGACGAAAAAAAAGTTTTGAAT. Deletion right flank: AGTAAAAGAATGATGAATTTCTTTTCCGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K11G12.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54C1.5. External left primer: CACGTGCACCGAATCAATAC. External right primer: TATTGGTCGCGTTCAAACAA. Internal left primer: CGGGTTTCTTTCGTGTTGAT. Internal right primer: ACTCGAGGGAAAGGAAGAGG. Internal WT amplicon: 1849 bp. Deletion size: 1342 bp. Deletion left flank: GCATCGCATTCATTTTGACAAGCTTACACA. Deletion right flank: ATAACTTCAATTGACATATTTTTAATTTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F46F6.4. External left primer: GACTTACCACCGGCTTGTGT. External right primer: TGGATCGAGTCAGTCTCGTG. Internal left primer: GCTTTGTCTTGGAAATGGGA. Internal right primer: TGACGGTAAGGCTACACACG. Internal WT amplicon: 1942 bp. Deletion size: 669 bp. Deletion left flank: AGTGTGTCTGCAGAGGGAAAAGTTATAAAA. Deletion right flank: GAGCCCCACATTATCGTCAATCTAAAATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T26A5.3. External left primer: CGAGCATCTTTTGATGCAGA. External right primer: TGCTGTGGTCCAAAGTTGAG. Internal left primer: CTTTCATGAGCCGAGTCACA. Internal right primer: ATTTGATCGTCGAAATCGGA. Internal WT amplicon: 2684 bp. Deletion size: 910 bp. Deletion left flank: AGTTTCAAAGAGTGGAGGAATGGGTGGCAT. Deletion right flank: ATGCTTTCGCGATCATTGCATCCTCTTCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F46F6.4. External left primer: GACTTACCACCGGCTTGTGT. External right primer: TGGATCGAGTCAGTCTCGTG. Internal left primer: GCTTTGTCTTGGAAATGGGA. Internal right primer: TGACGGTAAGGCTACACACG. Internal WT amplicon: 1942 bp. Deletion size: 989 bp. Deletion left flank: TGTCCCTGGAAACCAGAAATTCAGGAGTAG. Deletion right flank: ACAAACTTTAATATCAGAAATCCATTTCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk822) in ZK634.8, detectable by PCR using the following primers. External left primer: GCATCATTCTTTCAGTCGCA. External right primer: TGAGCTCGACGATGAATCAC. Internal left primer: CCACGTTTCGTCATTCCTCT. Internal right primer: GAGGATTCACCACCTCCTGA. Internal WT amplicon: 1922 bp. Deletion size: 1185 bp. Deletion left flank: GCTGCGGAGGTGGCGGAGGATGTGCTCCAC. Deletion right flank: AAACATATCAACGAAGATTACATTATTCAG. Validation: gk822 passed by CGH. Other deletion (gk3129) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y76A2A.1, T27E9.7. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2388 homozygotes (small, sickly, tends to die out but populations are possible to maintain). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGAAGCAGTTGATAGCCTCG. External right primer: CGTCGCTTTTTCCGTGTATT. Internal left primer: ATAGCTGTTTCATCGGGCAC. Internal right primer: AATTTAGGGTACCCCATCCG. Internal WT amplicon: 3031 bp. Deletion size: 1245 bp. Deletion left flank: CAGGCTAAATTAGCATATTTACACAGACGA. Deletion right flank: CCGCTTGAAGAGCAGTTTTCTCTGAAGCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F42A10.1. External left primer: TCCGGTTTTCATCGTCTTTC. External right primer: ATGCTTGCTCGTTGTCTGTG. Internal left primer: TATCTCACGGCCACTTTTCC. Internal right primer: AACCGAATGCGAAACAAAAC. Internal WT amplicon: 2429 bp. Deletion size: 1913 bp. Deletion left flank: ATCTTTGCGAGGTTGGAGCTAAGAATGCTT. Deletion right flank: TTTTCAAAAAATATTCATTTTTTCCTAGAA. Insertion Sequence: TTTTTTCAAAAAATATTCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

madf-9. Homozygous viable deletion, detectable by nested PCR. External left primer: AACAAAACGCATAACCTCCG. External right primer: TCGGCCAAACTTCATTTTTC. Internal left primer: AAAGAGAGAAGAGGGAGCCG. Internal right primer: GGCCAAATCTTTGTGGTTTG. Internal WT amplicon: 1269 bp. Deletion size: 784 bp. Deletion left flank: CCTCCCAACCGCACACATACTACCAACGAT. Deletion right flank: TTAAATTGAGAAATGAAAAAAAAGGTCACG. Validation: gk3057 confirmed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1056) in F47G4.6, detectable by PCR using the following primers. External left primer: CGCTTCTCCTGAGGTAGTGG. External right primer: GGACACTTCGAACCGGATTA. Internal left primer: ACGATGGATCGGTGTTTCTC. Internal right primer: AGCTGCCTAGCCTTCTCCTC. Internal WT amplicon: 1914 bp. Deletion size: 457 bp. Deletion left flank: TTAGCCTAAAAAATTTTTCCGAATTTTCTC. Deletion right flank: AGCTACCGTACTCATAAGCTACAGAGTGTA. Validation: gk1056 passed by diagnostic PCR and CGH. Other deletion (gk3330) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0511.10. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2607 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TAATCTCCGTGTTTGCCACA. External right primer: GATGAGAAATCCCTGACCGA. Internal left primer: TCGCCTTGACTTTGTCTTGA. Internal right primer: GACTCCGTTGTTGCCATTTT. Internal WT amplicon: 1140 bp. Deletion size: 578 bp. Deletion left flank: GTTCAGCTTCCTCTTGGCTCATATTCAATC. Deletion right flank: CCATTCTTGGAGCAGAATTTCACTGGCCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C02H7.1. External left primer: TTCAAGGAATGGTACCGGAG. External right primer: GGGCATTTCCAAGTTTTTCA. Internal left primer: GGAAACGCATGAAGAGAAGG. Internal right primer: CCTTGCTAGCGGATAAGCAG. Internal WT amplicon: 1196 bp. Deletion size: 647 bp. Deletion left flank: ACTGTTATATCAAATATGGAAACTGATTTG. Deletion right flank: AAGATTTAGTTGATGAAGAAGATAGAGGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T12D8.7. External left primer: ACGATTCTCACGGAAACGTC. External right primer: AAGGTGGCTCCAAACAACAC. Internal left primer: TTCCATTAATTTCCTCGGCA. Internal right primer: TTCTACCCCGCATTTTTCTG. Internal WT amplicon: 1258 bp. Deletion size: 427 bp. Deletion left flank: GCCCAACGATCGATTCTGTCAATTACAGCA. Deletion right flank: ATTTTCCGACACTACTTGAATAACCCCATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R08E3.4. External left primer: TGGCATCAACAAAGAAATGG. External right primer: AGCTGCGTCTCTGATTGGTT. Internal left primer: CTCTGTTGACGATGCTCACAA. Internal right primer: ATGAAAGACAAAGGTTGCGG. Internal WT amplicon: 1292 bp. Deletion size: 571 bp. Deletion left flank: TGACTCATTGGCTGGCGGCGAGTGCGACTG. Deletion right flank: ATATCACATGATGAGAGAGATTCCACGGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1128) in W02D9.3, detectable by PCR using the following primers. External left primer: ACGGATTTTGCCACTTTGTC. External right primer: CATCACATTTCTCGTGGTGG. Internal left primer: TTGGAGAGGTGTGAACGTAGAA. Internal right primer: TTTCTAGGCCGTACGTTGCT. Internal WT amplicon: 1621 bp. Deletion size: 1315 bp. Note: internal left primer binding site deleted in gk1128; major deletion product from nested PCR runs at about 650 bp. Deletion left flank: GCAGAAAAAATTTTGGAATTTGAGCTACAT. Deletion right flank: CATTTTCTTGCAGAAAAACGTGCAAAATTC. Validation: gk1128 passed by CGH. Other deletions (gk3217, gk3218) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

attf-5 homozygous viable deletion, detectable by nested PCR. ceh-90 homozygous viable deletion, identified by CGH. gk1279: External left primer: ctcccgaaaatccagcatta. External right primer: aactcatggaaaccgtcctg. Internal left primer: ccatagcaactgcgatgatg. Internal right primer: atgagcattagagcgcgatt. Internal WT amplicon: 2677 bp. Deletion breakpoints not determined; deletion of approximately 1030 bp narrowed to 1142-bp region between X coordinates 788497 and 789639 (WS279). Validation: gk1279 confirmed by CGH. gk3396: Left flanking probe AACAACAAACCTGAGCTTCGTTTCGATTCAATAAACCAGCAAGACGATTC; left deleted probe: ATAAACCAGCAAGACGATTCATTTCAGAAGTTCCAGGGTGTGAGTCTTTT; right deleted probe: ACAAGTTTTTCGGATGGAGAATTACCTAAAATGTCGATGAAAGATTATTG; right flanking probe: ATTGAGAGATAGAACCATAGAAAACACTAAATACGCAGATAGGTTATCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F11A1.3, F11A1.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y92C3B.2. Apparent homozygous lethal deletion chromosome balanced by dpy-1- and lethal-marked recombination suppressor. Heterozygotes are WT, and segregate WT, occasional Dpy (non-let recombinant sC1 homozygotes), and gk1036 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GGAAAGATGGATTTTTCGCA. External right primer: AAAATTCGTGAAAATTGCCG. Internal left primer: ATTTCTCGCTTCCACGACTG. Internal right primer: TCACAGGAGCACATTTGACC. Internal WT amplicon: 1125 bp. Deletion size: 606 bp. Deletion left flank: ATAGATTTTTGGCAAAGAAAATGAAAATTT. Deletion right flank: GGCGTTCAATATCTTCAAGTTTCATGCCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C06A5.9. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45G2.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1721 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTGGATTACCAGCGGACTGT. External right primer: AGAGGCAAAAGCAATGATGG. Internal left primer: TCCGATCAAGCTGAACTGTG. Internal right primer: CGCCTTTTCTCCCCTACTTC. Internal WT amplicon: 2848 bp. Deletion size: 954 bp. Deletion left flank: AAAACGGGGGTGAAGCCATTTACTTTCAGG. Deletion right flank: ATTTGGTTATAAGATGATGGCTTGTGCATG. Insertion Sequence: TCTTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1287) in C06E1.8, detectable by PCR using the following primers. External left primer: CCCGCAAACAGGAAGAAATA. External right primer: CTGCTGCTCCAAAACATTGA. Internal left primer: GCACAGTTTGTTCCAATCCA. Internal right primer: TTCTTCTTCCTCCTCCGTCA. Internal WT amplicon: 2185 bp. Deletion size: 1044 bp. Deletion left flank: TGTTGTTGCTGTCATTGTTGTTAGTGGCAG. Deletion right flank: AATCATTATAAAAGTAAGAACCTAATCAGA. Insertion Sequence: CAG. Validation: gk1287 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59B10.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3445 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCCGTAGTTTCGGTTATGCC. External right primer: AGCTTTGCTGGTATTGACGG. Internal left primer: TCAAGGACATAAAGAGCTGACA. Internal right primer: GTCAGCAACAGGCAATCAGA. Internal WT amplicon: 1381 bp. Deletion size: 636 bp. Deletion left flank: GAAGACAAGCGGCCATAATGGAAACCAAGG. Deletion right flank: ACAGGGCTCCTCCATTTCGTTGCCATCCAA. Insertion Sequence: GCTCCTACAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45E12.2. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and gk17 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous lethal deletion chromosome (gk3159 in Y116A8C.35) balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3159 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCTGAGCAGTTTGCAGGTG. External right primer: TTTCTGTAAAAATTGGCCGC. Internal left primer: CTCCATATCCGTAGCCTCCA. Internal right primer: GATGCAAGAGACGCAGAGAA. Internal WT amplicon: 2193 bp. Deletion size: 871 bp. Deletion left flank: CCGCCTCCGGAACCTCCACGTTGTGATGGA. Deletion right flank: AGTGGCACGTTCTCTTCACAGCACTTGAGC. Insertion Sequence: G. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T13C5.1. Heterozygotes are WT and segregate WT, arrested szT1 aneuploid progeny, Lon-2 males, and homozygous gk160 hermaphrodites (arrested dauer-like larvae). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y53C10A.12. Replaces strain VC358. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok600 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CAAACAACAAATCCTCGGCT. External right primer: GCTCAATGCGTCAACAACAT. Internal left primer: GTGGATGAGGTGGAAGTCGT. Internal right primer: GTCGCGAAACGGTAATCAAT. Internal WT amplicon: 2605 bp. Deletion size: 877 bp. Deletion left flank: ATGAGTCAATGGACCGGATCCCATGTACAT. Deletion right flank: TTCTAAGAAATTTTTATTTTCTGAAAAATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48C3A.4. External left primer: CCATTTCTAACATAGGGGCTTTATT. External right primer: TATTTCGGCATTTTACCAAATTTTA. Internal left primer: TGTGAAAAAGAGCCAAATTGATAA. Internal right primer: GAGGTTTTTCCTGAAAATTGAAAA. Internal WT amplicon: 1190 bp. Deletion size: 369 bp. Deletion left flank: TTTGGAGCAACGTGTTTAAAGTGTTGAAGA. Deletion right flank: GGTTGGCAAGTGTTAAAATGTCCAAATATC. Validation: gk3235 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk2191) in Y66H1B.2, detectable by PCR using the following primers. External left primer: AGCGAGTCCAGTGTCGATTT. External right primer: ACGTGAAGCTGGAGAGCATT. Internal left primer: GACATCCTTAATCCGGACCC. Internal right primer: AGAACCAGGAGTCTACGCGA. Internal WT amplicon: 1864 bp. Deletion size: 1225 bp. Deletion left flank: ATGGATTAGATACTTCTCTTCTAACTTTAT. Deletion right flank: CATTTTTATTTCCTAGTGAATATTACCTTA. Insertion Sequence: TTTTCCCATATTTCAGATATTACTACAATACGCTCGGTA. Validation: gk3291 passed by CGH. Other deletion (gk3543) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F28C6.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1220 homozygotes (sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TTCTTCCGAGTGAACTGGCT. External right primer: AGCACACATGCAGGTTGAAA. Internal left primer: CCATTTGAAGCAGCCAAGAT. Internal right primer: TACGATTTGAGGGGAGATCG. Internal WT amplicon: 2198 bp. Deletion size: 1785 bp. Deletion left flank: CTTTCTGTCGGAATTGCGAGCATCCCACGA. Deletion right flank: TTAAACTTATATTAAAGGCGCATGCCGTTT. Insertion Sequence: ACTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48C3A.4. External left primer: CCATTTCTAACATAGGGGCTTTATT. External right primer: TATTTCGGCATTTTACCAAATTTTA. Internal left primer: TGTGAAAAAGAGCCAAATTGATAA. Internal right primer: GAGGTTTTTCCTGAAAATTGAAAA. Internal WT amplicon: 1190 bp. Deletion size: 407 bp. Deletion left flank: CAGAGGCGTTGTTGTTGGTGAGTGACTAAT. Deletion right flank: TTTGTAAATTCTGAAAAATTGCCACTTTTA. Validation: gk3296 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK484.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C07G2.2. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk3083 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTCCATTCGTGTTTCGATGA. External right primer: AGTTATCCCCACCGCTTTTT. Internal left primer: AACCGGAAAAATTCCAAACC. Internal right primer: CTTCTTCGCCGTTTCACTTC. Internal WT amplicon: 2013 bp. Deletion size: 836 bp. Deletion left flank: CCGTTTTGTGGACGTCCAACTGGATTTCCA. Deletion right flank: TTGGCTTCCAAAGCTTCAAGAGATTGATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3265) in F40H3.2, detectable by PCR using the following primers. External left primer: TTCCATTCGTGTTTCGATGA. External right primer: AGTTATCCCCACCGCTTTTT. Internal left primer: AACCGGAAAAATTCCAAACC. Internal right primer: CTTCTTCGCCGTTTCACTTC. Internal WT amplicon: 2013 bp. Deletion size: 819 bp. Deletion left flank: GAGCCGAGAAGTCACCGGCCTGAAAACGTT. Deletion right flank: GCTAGAGGAGCAGCAGCAATACAGCTCATC. Validation: gk3265 passed by CGH. Other deletions (gkDf40, gk3266) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59B10.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk3366 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATCCATTTGAATCCTCGCTG. External right primer: AGCTTCCGATACAATGCCAC. Internal left primer: GTACCGGTGATTCGCTTTGT. Internal right primer: GAGCCGATCGTAAACCACAT. Internal WT amplicon: 1767 bp. Deletion size: 761 bp. Deletion left flank: TTACAAGATGGATTGAAGCATTTTTCAAGT. Deletion right flank: CGAATATCGGATGGATTGATTATTCGGCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C47C12.3. Heterozygotes are WT and segregate WT, arrested szT1 aneuploid progeny, Lon-2 males, and homozygous gk178 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F59A2.4. Deletion balanced by glp-1 and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and ok3753 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GAAACACCAATGGATTTGGC. External right primer: CCAGGCTTGCAAATAAGCTC. Internal left primer: AAAGTCAATTTCGGCCCATT. Internal right primer: TTGAGGACAAAACCTACCCG. Internal WT amplicon: 1279 bp. Deletion size: 698 bp. Deletion left flank: CCGAGAGCGCATACGTTGCCGAGAGCACTC. Deletion right flank: AAATCTATCTCTCTACGAAGCATTGTTCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54C9.8. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and GFP- ok464 homozygotes (probable embryonic arrest). Some heterozygotes appear to be sterile and even those with eggs seem to grow a bit slowly. Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 850 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CCCCGTAATAATCCCTGTTTTTTCCAGCAG; Right flanking sequence: TCATCATCATCTTCCTCCCACTGGTCTGGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

[NOTE: Please see RG5004 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 717 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTTGTTATCCGATGGCCAAAAAATTCGCCT. Right flanking sequence: AATGATATCCGAATGTACCATATGGTTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2622 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GTCATTGGGAACATCACTGATTTATCCCCG; Right flanking sequence: TCTCTCTTTATCCGTTTTCAACATTTTGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

T26A5.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807