Y57G11C.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T08G5.10. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F20C5.1. Him. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK337.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK337.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T16G1.11. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F46H6.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K02B9.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K02B9.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F09C3.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F25B5.7. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1206 homozygotes (Unc, nearly Ste, has a few progeny but can't maintain population). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACCCCGTGACGAGATATCAG. External right primer: TCAAATTGCAACTCAACCCA. Internal left primer: AATCGGGAATTGGACACAAC. Internal right primer: TCGCATTATATCGCAGCTTG. Internal WT amplicon: 2308 bp. Deletion size: 1026 bp. Deletion left flank: ACTTCACAAATCAGTGGTTTCGGACTCCTA. Deletion right flank: AAAAGAAAACTCTAGAAGCTTCATAAATAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C36E8.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C52B9.3. External left primer: CTTGTTTGTTTGTTGGGGCT. External right primer: CGAAAAGGCCACAAAAATGT. Internal left primer: CGAACGGAAGGTACAAGTCC. Internal right primer: ATGGAACACAAACAATGCGA. Internal WT amplicon: 1813 bp. Deletion size: 207 bp. Deletion left flank: AAAGACAGCTAGCAGTCACTCAGCTGATCA. Deletion right flank: AGCCAGAGAGCCCTAGAACTTCTTGTGCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M02H5.3. Identified by PCR, validated by CGH. External left primer: TTGTTCCCCAGCACTTTAGG. External right primer: CTCCCGAAACACGGCTAATA. Internal left primer: TAGAACCACATGGTTTCGCA. Internal right primer: TTCCGGGTGCGAGTATTTAG. Internal WT amplicon: 1776 bp. Deletion size: 764 bp. Deletion left flank: GCTTTGAAAGTTATTCGGAACATACCACAG. Deletion right flank: CTCCCAAAATTAACCTAAAACTAAAAAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T28F3.1, M01D1.1. The allele gk1230 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: CATGGTCAACGAAGCTGAGA. External right primer: GAGAGGCAGAACCGAAGTTG. Internal left primer: TGCGACGAGATCTTGAAGTG. Internal right primer: AAAGCACATTTGGGCAAGAC. Internal WT amplicon: 2703 bp. Deletion size: 1246 bp. Deletion left flank: TTATTCTCTTTTCCCCCAAATCCCCTATAT. Deletion right flank: GGCAAATGGATAGCACGGATCTGAAATTAA. The allele gk3036 was identified by CGH but not confirmed by PCR. Left flanking probe: CTTGTTGCCCATCTCTGATTTACAACTCGGCCCATAGCGTAATTAAAAAT. Right flanking probe: GATATCCCTTCGAGAATAATATCAAAGTTAAATGTATCTTCATGTCGTTG. Left deleted probe: CACTCCAATTTTCCACGAAAATGCTTTGGCTGCATATCATACAATATTCT. Right deleted probe: ACTACCAGTTCACGTGCAGTTTGAGTTTGTTTCATCAAACCCATTAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y41D4B.7. External left primer: GAAACCACAAATTACCCCCA. External right primer: AACCACATTTCGGCTGTTTC. Internal left primer: CACTTCATAGTGTGGGCGTG. Internal right primer: AGGATTCCGATTGACCTTCC. Internal WT amplicon: 2253 bp. Deletion size: 1371 bp. Deletion left flank: AAGTGACGTCACACTTCATAGTGTGGGCGT. Deletion right flank: ATAACTTACAGAGTGATGAAAGGAACGTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C52G5. Identified by PCR, validated by CGH. External left primer: TCTTGGCTTTCTGACGTGTG. External right primer: CGTCGTTGGCAAAGGTAAAT. Internal left primer: GTTGAGTGAGCAATGACGGA. Internal right primer: TGCGAAATTTACGCCATACA. Internal WT amplicon: 2398 bp. Deletion size: 977 bp. Deletion left flank: CAGGAACGATTTGCAAACTTCCTGTATAAT. Deletion right flank: GAAAATATCACTAGATATTCTCTTATTCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T13B5.5, T13B5.6, T13B5.7, Y53F4B.25, Y53F4B.27, F55C5.6, F55C5.7. The allele gk1208 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: AACTTCGGGAATGTCAATGC. External right primer: CAATTTTGGACCAACCCAAT. Internal left primer: GCCAGAGACCTTCCACAGAG. Internal right primer: ACTTTCAATTTCCGGACGTG. Internal WT amplicon: 2542 bp. Deletion size: 1329 bp. Deletion left flank: TCCCGGTTCTACGAATTCCAGAAGTAATAT. Deletion right flank: CTTCAGCTCTTTGAGCCGTTGCCACTAGCT. The allele gkDf19 was identified by CGH but not confirmed by PCR. Left flanking probe: AATGTGGAAAAGGGCTACTCGCTTGTCTATGCTGAAACGTAGGTTGTGAA. Right flanking probe: CACTTCATCTCAAGATTTCGTTGAGAAGTGTCGGTTGTATTGCCCCATGT. Left deleted probe: GATCTGGCAAAATGTTGTTGAAAACTTAAATTTTTCCACCAAGTTTTTGT. Right deleted probe: AATTGGGGATCCTTCTCCATGTGCCACAATATCAACCTGATTATTCGTAA. The allele gkDf20 was identified by CGH but not confirmed by PCR. Left flanking probe: ATGCTGTGAACGTGCTGGAATTCTATCGTTCCAAGGCGGAAAATGTATTC. Right flanking probe: GAAACTATGCGATTCGAGTGGAGAATAAGAAAAAGTCATCGTTGATTTCT. Left deleted probe: ATGTATTCCATTCTGTCGAACCCACGTGGCAACTCCTTCAAATGTTTTCG. Right deleted probe: TGGGAAAAGCCGGCCACCGCCATCTGGAAACTATGCGATTCGAGTGGAGA. The allele gk3058 was identified by CGH but not confirmed by PCR. Left flanking probe: ATCAAACCACTCTGGAAGACGATTTCATGGTTTTCGAGCCCAGTTCATGG. Right flanking probe: AATTCACTGTTTACCACTCTGTGAACCTGGATGTGTCAAGGGGTGCGACC. Left deleted probe: TGTTTATATTCCTGGAAACAGCATATAACCTTCTCTGTAGATTCAACGAT. Right deleted probe: AGTGTACAAGTGGCAGGTCACAACAGTATACTCTACGTACCAACTTCCGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C47E8.6. Identified by PCR, validated by CGH. External left primer: CCGTTACCATGCCAACTCTT. External right primer: TGATTTTGGCCGAGTAGGAC. Internal left primer: CCGTCACCTCTTAACGGAAA. Internal right primer: CGAACCAACCAGAATCTTCG. Internal WT amplicon: 1333 bp. Deletion size: 884 bp. Deletion left flank: TTTTGTTTCAGTTTTCATCGTAATTTTTTT. Deletion right flank: TTTCTTGCAGGTAGGAACTCTGAATATTCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Unc-22 twitcher. The gk1237 lesion is a point mutation (C to A) with flanks TTCCATATGGATTGGACACCTCGACTGTGT and CTCTCCAGCATCAATGTCCCAAACTTCCTT. The gk1238 lesion is a 122-bp deletion with flanks CTCCATCACTTGCTTCGAATCTATATCTGC and ACGATTTGTGGGCGACTTCCACCGGATTCC, and a single inserted base (C) at the break. Primers to amplify the region are: cggatgcttggaacaaagtt and tgctcgtgtcactggacttc. This strain was isolated after UV/TMP mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk1237gk1238), it is homozygous for 90 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200

attf-5 homozygous viable deletion, detectable by nested PCR. ceh-90 homozygous viable deletion, identified by CGH. gk1279: External left primer: ctcccgaaaatccagcatta. External right primer: aactcatggaaaccgtcctg. Internal left primer: ccatagcaactgcgatgatg. Internal right primer: atgagcattagagcgcgatt. Internal WT amplicon: 2677 bp. Deletion breakpoints not determined; deletion of approximately 1030 bp narrowed to 1142-bp region between X coordinates 788497 and 789639 (WS279). Validation: gk1279 confirmed by CGH. gk3396: Left flanking probe AACAACAAACCTGAGCTTCGTTTCGATTCAATAAACCAGCAAGACGATTC; left deleted probe: ATAAACCAGCAAGACGATTCATTTCAGAAGTTCCAGGGTGTGAGTCTTTT; right deleted probe: ACAAGTTTTTCGGATGGAGAATTACCTAAAATGTCGATGAAAGATTATTG; right flanking probe: ATTGAGAGATAGAACCATAGAAAACACTAAATACGCAGATAGGTTATCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y23H5A.5, C41D11.1, C41D11.6, F21H7.9. The allele gk1227 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: AATCACTTTCGGTGCAGCTT. External right primer: GTATGCCCCACAGTTTTGCT. Internal left primer: AGTATCGCGGCATTGTTAGC. Internal right primer: TGCTCAAGCTTGGAGAGACA. Internal WT amplicon: 2419 bp. Deletion size: 367 bp. Deletion left flank: GCTACCACGGAACCTGAATTAGAAATTTCT. Deletion right flank: TATAAATCGTTTAAAAGAGTGACCACTTGC. Insertion Sequence: C. The allele gk3037 was identified by CGH but not confirmed by PCR. Left flanking probe: TCAATTTTGCCCGATCATATGAAGTTTGCAGTTTGCAACCTGTAGTTTGT. Right flanking probe: GAGAACTTGGAGGTGTTCTGTGACACCTGGGGGCAGGCGGTGAGTTATTG. Left deleted probe: AATGTTAGAATCAGCGTGGTCCAGCCTCGTTAGGTAGTCTCTCCGCCGCC. Right deleted probe: GTGCACCCATCTTCGAGGATAGCCAGGGAGAACTTGGAGGTGTTCTGTGA. The allele gk3038 was identified by CGH but not confirmed by PCR. Left flanking probe: AGATGAAGAAATGGGTAGGCTTTCCTTGCTCCCATGATTCCGAAGTTGAT. Right flanking probe: TTTTTAGGCGTTGTCGAGGCCGTAGCCGCCAAAAACGTTAGGCCGCGCAT. Left deleted probe: GATGACTTGTGGACGAAGATCCCATGACTTACTTTGAGCTGCAGTTTCTC. Right deleted probe: GTAAAATCAAATACGCGGAAGTATGTATACCCTTGCCTACTCTAGAATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47G6A.5, K02B9.1, K02B9.3. External left primer: TAGGGAATATCGATCGGCTG. External right primer: CGCGTCAATCATGGTGTATC. Internal left primer: TTCAACTACCGTAGCCGAGG. Internal right primer: GATCCGAAATGAATAACCGC. Internal WT amplicon: 1768 bp. Deletion size: 371 bp. Deletion left flank: TAACATTTCGCGGCATCCATCAGCAACTTC. Deletion right flank: GCAACTTTTTCAAAATTAAAAAAAAACAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1292) in F45C12.1, detectable by PCR using the following primers. External left primer: GCGCGCATAATTATCACCTT. External right primer: CACTGCACGCAGACTTTGAT. Internal left primer: AACTGCACATTCCATCACCA. Internal right primer: GTAGAGGACCACAGGTTCCG. Internal WT amplicon: 1555 bp. Deletion size: 1237 bp. Deletion left flank: CTCGCAAATAAAAAGCTTTTCCATTTTCCA. Deletion right flank: TGGGCCCAAAACCTCTACAGATTTATGCCA. Validation: gk1292 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1287) in C06E1.8, detectable by PCR using the following primers. External left primer: CCCGCAAACAGGAAGAAATA. External right primer: CTGCTGCTCCAAAACATTGA. Internal left primer: GCACAGTTTGTTCCAATCCA. Internal right primer: TTCTTCTTCCTCCTCCGTCA. Internal WT amplicon: 2185 bp. Deletion size: 1044 bp. Deletion left flank: TGTTGTTGCTGTCATTGTTGTTAGTGGCAG. Deletion right flank: AATCATTATAAAAGTAAGAACCTAATCAGA. Insertion Sequence: CAG. Validation: gk1287 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C05D10.2. External left primer: CAACTATTCTAGAGCCGCCG. External right primer: GCACGACTCTTATCTTCGCC. Internal left primer: ATACTCGGAGCGTGAGTCGT. Internal right primer: TCCGGAAGTGGTGGATAAAC. Internal WT amplicon: 2660 bp. Deletion size: 1407 bp. Deletion left flank: GTCATGATCATCATCATATTTTTATTATCA. Deletion right flank: GCTCCTCAAAAACGATTAACCGTTGAACAA. Insertion Sequence: TTTTTATTATATATTATCATTTTTATTATTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C45G9.1. External left primer: GAAGGCCGAATCAAATGAAA. External right primer: AAACTGCGAGAAAATCCGAA. Internal left primer: CCTTTGCGCGTAAGATATGG. Internal right primer: ATCAATTAGGCTTCGGGCTT. Internal WT amplicon: 1743 bp. Deletion size: 1228 bp. Deletion left flank: TCTCCTATATGGTCATGACGTTATTGGGGA. Deletion right flank: TCTTATGGAAAACAAAATTTAATATTCTAT. Insertion Sequence: TGGAAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F33D11.7. Identified by PCR, validated by CGH. External left primer: TTGGCTGCCTACTCTCCACT. External right primer: TTTACGTGTTCGGCCTTGAT. Internal left primer: GACCATTTCGGCACAACTTT. Internal right primer: ATACGATCTACGTGGCGGAG. Internal WT amplicon: 1225 bp. Deletion size: 945 bp. Deletion left flank: CACGTTGGAGCAACATGCACAAGACACTGA. Deletion right flank: TGTTACAGAAATATTGATACTTATACATAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C25A8.5, F45H7.2. The allele gk1224 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: GTGGAGCGTTCGGTACATTT. External right primer: TCACACCCCTGACAGGTACA. Internal left primer: AACGGAACCGTTGAGAATTG. Internal right primer: GCCGCCTCACAAGTTAGTTT. Internal WT amplicon: 2303 bp. Deletion size: 1432 bp. Deletion left flank: TTTCCAACGAAAATGTGACTTTTTCAGGAA. Deletion right flank: ATCTACCCATCTTGAGATCAAAACTTTCGA. Insertion Sequence: CAATTTTATTTTAAAAAATGCTCTGTGCCGCTTTTGTCGATACAACTTCTGAAATTTTC AAAACCACCGCGGTGCCTCCCAGTAGGACTTCAAAAATTG. The allele gk3062 was identified by CGH but not confirmed by PCR. Left flanking probe: GAAAAAGATGGATCTAAGATCCACTAATAAGTGAGTACACATACAGTGTG. Right flanking probe: GAAATTTGATTCCGGACCGTATGTACGATGATCTCGATGACCTACCTCTG. Left deleted probe: ATCTACTGTTTGCAGACGACCAAAAGAAACACGTGGCAGACCTGCTCCAA. Right deleted probe: GTTATTTTGTTTTTATCAGCTTCAAGGCGGTCTACATCTGCCTTGCGCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK270.2. Identified by PCR, validated by CGH. External left primer: AATGGTGACACGATGCTCAA. External right primer: ACACAGACACAGCAAGACGG. Internal left primer: GTTAAATTCCAGTGGCTGCG. Internal right primer: GAAGCCGATGGACAAAGAGA. Internal WT amplicon: 796 bp. Deletion size: 98 bp. Deletion left flank: AAGTGATCATTCGACCTTTAAAAGTGATGT. Deletion right flank: TTTGGGTGTACCAGTTAGATATATTGGGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC374.2, B0564.10, Y67A10A.104, T13F3.1. The allele gk1222 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: TTGGAAGTTTTGGCAGGAAT. External right primer: CTTGCGTTAATCGCATGTGT. Internal left primer: TCCAATTTGAGCGATCAGTG. Internal right primer: AGGACGCGCAGATTGTTAGT. Internal WT amplicon: 2448 bp. Deletion size: 1618 bp. Deletion left flank: CATTTTTCAGTGCTGTTTCTTCCACATTAT. Deletion right flank: TCAGATCTTCTAACTCGCGTTTCTAACTTT. The allele gk3024 was identified by CGH but not confirmed by PCR. Left flanking probe: TTTCGACTGCTGCAAATTTGGCACCTCTACCAACGTGAGTTTTACGGATA. Right flanking probe: TTGTTTGAGCTGCCGGGATGCCAGGAGGAGGGAACAGACAGAGCAGGTAT. Left deleted probe: AAAAATTATAATTTACATTTTTCCAGAGCCCAAGCTGCATTCTCCACATC. Right deleted probe: TTCCTCATCGCTCGGCCAACCTTATCAACCCTGTCAGTACAGTGGACCAC. The allele gk3025 was identified by CGH but not confirmed by PCR. Left flanking probe: GGGATTCGTGGTCGAGATTGCCAGTCCAAGGCTTGGTCGGTTTCAGGTTG. Right flanking probe: GGTTAATGTGAAACTTGATTTAACTGTTCCACGAGTATGCTTTAACAATA. Left deleted probe: TGATTCGCAAAAACAACGAATTGTATAGAACTCACACTTTAAGACATCTA. Right deleted probe: AAATTGCTTACTGACTTTGATGCAAAACAGGTGATTTTTCGGGTTCTAAA. The allele gk3061 was identified by CGH but not confirmed by PCR. Left flanking probe: CAGATTATCTCACTTACTGTTATTGCATATTGTGGGACATGTTGCTACTA. Right flanking probe: GGATCACATACTAAACTTAATTCTTTTCAGACCGCAATACCAATGCTTCT. Left deleted probe: ATATTGTGGGACATGTTGCTACTATAAAATACAACAGCAAATGAGGGTTG. Right deleted probe: ACCTACATCGTCAACTGTTCTACGCTTTGGCAATCCAGGTTTGACGCAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC374.2. Identified by PCR, validated by CGH. External left primer: CGCTATCCGTTCTCTTTTGC. External right primer: GACAGGTGTGCGAGGTATGA. Internal left primer: ATACCTTTCCGACGTGCAAT. Internal right primer: AATATGACGAAATGTGGCCC. Internal WT amplicon: 2736 bp. Deletion size: 940 bp. Deletion left flank: GATAATGAATGTGAAAGAATGAAGTTAATT. Deletion right flank: CTTACAAATTGCAGAACTATTTATTAGAAT. Insertion Sequence: AGAAAGAATGAAGTTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F01D4.3. Identified by PCR, validated by CGH. External left primer: TCCTCCAATGGTGGTTGACT. External right primer: CCGGATGGAGACAAAAAGAA. Internal left primer: ATCACTTGCTCCGGTTTCAC. Internal right primer: CCAATTCAGTCTGATGGCAA. Internal WT amplicon: 1179 bp. Deletion size: 505 bp. Deletion left flank: TTTCTCCGCAATCGGTACAACAGTTCCAGT. Deletion right flank: CGCTATTCCAAATACATTTTTCTTTTCAGT. Insertion Sequence: TT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK524.4. Identified by PCR, validated by CGH. External left primer: GAAGTACCTGCTGCTTTGCC. External right primer: TATATGCAACTGCGCTCCAG. Internal left primer: GCTATTGCTCCAGCAACCAT. Internal right primer: TATGTCAAATGCGCCTGAAA. Internal WT amplicon: 1629 bp. Deletion size: 823 bp. Deletion left flank: AGCATATACAAAATAACACCTAATGACCAT. Deletion right flank: CCCTGATGTGCAACGATGATTTTCGGCGGA. Insertion Sequence: GTTCAGCATGGTCAAATATAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y80D3A.4. Identified by PCR, validated by CGH. External left primer: ATCCAAAACTTCAGAACCTAGCC. External right primer: CCCATTCTCTTCTTCTCCATCTT. Internal left primer: CCGAGTTTTTCAGAACCTAGTCA. Internal right primer: ATTTGAGATTTTCGGCTTATTCC. Internal WT amplicon: 1092 bp. Deletion size: 244 bp. Deletion left flank: TTAAAAAAAGTGTTTTCGGGAATTTCAAAA. Deletion right flank: CTGGCTGAGTTCTAGAAACATAGGTTTTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T01D3.2, F35G12.4. The gk1280 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: GTGAAGCCGAAGGATCATGT. External right primer: CGTCTTTGCTTTCTTTTCCG. Internal left primer: GAAGAACTTTGCATCGAGGG. Internal right primer: TGTCCAACAATTTCCAACGA. Internal WT amplicon: 1737 bp. Deletion size: 245 bp. Deletion left flank: TTGCACATTTGAGGCCAATTAAGGTCACAA. Deletion right flank: TTCAAAACTTGTAACTATAATAAAATATTT. Insertion Sequence: ATTTCAGGATGTTTTTGTGAAAG. The gk3152 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1211) in T01D3.2, detectable by PCR using the following primers. External left primer: GTGAAGCCGAAGGATCATGT. External right primer: CGTCTTTGCTTTCTTTTCCG. Internal left primer: GAAGAACTTTGCATCGAGGG. Internal right primer: TGTCCAACAATTTCCAACGA. Internal WT amplicon: 1737 bp. Deletion size: 301 bp. Deletion left flank: TTAAAAAACAGAAAAAAAATTAAAAATATA. Deletion right flank: CATCTCCGCGCCTGTCCAGTATCACAAAGA. Validation: gk1211 passed by CGH. Other deletions (gk3223, gk3224) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y79H2A.3. Maternal-effect lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1219 homozygotes (Mel; F2 homozygotes arrest as early larvae). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAACATGCTTCTTCCATGCC. External right primer: AGCGAAATTTGGACTAGCGA. Internal left primer: TTCATTGCGTGATATTCCGA. Internal right primer: TCTGGACGTGTGCTACTTGC. Internal WT amplicon: 1396 bp. Deletion size: 1073 bp. Deletion left flank: GTTCATCACCAGCATTAATGAGATATCGAT. Deletion right flank: TAGCTAATTTTGAACCGCCATAAAACTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R155.1. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and gk1217 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTTTAGCAAATTTTTGCGGG. External right primer: AAGTACGCAAACACCTTGGC. Internal left primer: GCTAACTCGGCCTTTACACG. Internal right primer: TTTGGAAACCCGTTGGATTA. Internal WT amplicon: 2401 bp. Deletion size: 1464 bp. Deletion left flank: GTCGATTGGACCCAAAAAATAGAATTTTCA. Deletion right flank: GTGAAAAAGTACAAGAAATTCAACTTTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0252.1. Identified by PCR, validated by CGH. External left primer: GTAAGCAGCTGCATGGTTGA. External right primer: TGTCTGATTATTTGCCGCAG. Internal left primer: ACTCCCAAAGAGTTCACGGA. Internal right primer: GAATTCTGAACGGAACGGAA. Internal WT amplicon: 1940 bp. Deletion size: 1584 bp. Deletion left flank: AAATCAAAAGATTTGAACTTTCAAAGACTC. Deletion right flank: ATTTTCAACAGAAACCAAAATGTGAGATAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M01B2.1. Identified by PCR, validated by CGH. External left primer: CAAATCAGCGGAAATACGGT. External right primer: CTGCCCGCAATTAGAATGTT. Internal left primer: AAGATTCGTCCGATCTGTGG. Internal right primer: TTTAGGCCGAAGAGTTGCAT. Internal WT amplicon: 2534 bp. Deletion size: 806 bp. Deletion left flank: GATCTCAGGAGTGTTTTGAAATACACACCA. Deletion right flank: CATCATAGCAAAAAATCTTATTACAGGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T09B4.7, F59A2.1. The allele gk1215 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: CGTCTTTCACTCGCCTTTTC. External right primer: CAAAATGGAGAGTACCCGGA. Internal left primer: TATTCTGTATGACGCCGCAC. Internal right primer: CCGGCCTGATCTGAGAGTAA. Internal WT amplicon: 2551 bp. Deletion size: 661 bp. Deletion left flank: AAAGAAATAAAGCTCCAGATGATATCACGT. Deletion right flank: GGAAAGCAACTTATCATTTCCCATACCAAC. The allele gk3059 was identified by CGH but not confirmed by PCR. Left flanking probe: TTCCATTCTCAATATTTGAAGGGAGTGTCTCCTCCGAAATGGTCACCTGG. Right flanking probe: CAGAACATGGTTTGCTCTCCTTCTTCTCCAGTTTTCACCTCGACAAGATC. Left deleted probe: GTCTCCTCCGAAATGGTCACCTGGTCTCGTCGCATAACAACTCTCCACGA. Right deleted probe: CGTTGGCATAAATGTAGAGTTTTGAACGATTGCAGAACATGGTTTGCTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45H11.6, F09A5.2. The allele gk1216 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: TCCTTATCGGGTGACTCCAG. External right primer: TAAGGCGCTGCTTTGATTTT. Internal left primer: GGACGGACACGTTTCAAATC. Internal right primer: TATTATTTGCCTGCTTCCGC. Internal WT amplicon: 1801 bp. Deletion size: 646 bp. Deletion left flank: GATGAAGAATGAGAAAGGAAATATTTGAAG. Deletion right flank: AATAATGTTGTCTGGTACAGGTATCAAATC. The allele gk3060 was identified by CGH but not confirmed by PCR. Left flanking probe: ATCAGCATGTTGGGATGTGTGTCAAATCCATATGAGCCATTGATCGTGGT. Right flanking probe: TGGTGAGTGACCTTTCCATAAACCGAATTACCTCGGAAAATGTTTTTAGA. Left deleted probe: ATCAGCATGTTGGGATGTGTGTCAAATCCATATGAGCCATTGATCGTGGT. Right deleted probe: GAGAAGACATAAAGATTATGTGCTGATGGTGAGTGACCTTTCCATAAACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C40D2.4. External left primer: CATACCCAAAGGTCTGGTGG. External right primer: GCACAACCTGTGCATGTAGG. Internal left primer: CCACAGACCCGCTATTAAGG. Internal right primer: TTCCCAACACTTCAACGTCA. Internal WT amplicon: 1685 bp. Deletion size: 518 bp. Deletion left flank: TCTCCTCAAATGCTGAAAGTGAATAAAGAA. Deletion right flank: CAAAAAATATTTTTCAAAAGATAACATAAA. Insertion Sequence: AGGTGATCTAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K09E4.1. Identified by PCR, validated by CGH. External left primer: TCGGCAAATGTGGTTTTGTA. External right primer: CGAGTTCTCTTCCTCAACCG. Internal left primer: ACACAATGGAGCAGCATCAG. Internal right primer: GGCAATCTTGTGGAACACCT. Internal WT amplicon: 1905 bp. Deletion size: 753 bp. Deletion left flank: CAAATTTTTTTGCCGATTTGCCGGAAATTT. Deletion right flank: GCGATGCGGAACAAGTTCACGCTTGGGACG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C52B9.3. Identified by PCR, validated by CGH. External left primer: ACATTTTTGTGGCCTTTTCG. External right primer: ATTCCCTTCTCATCCCTGCT. Internal left primer: TTTTCACTTGTCCCTCGACTTT. Internal right primer: TCGTTGAATGTATTTGCAGGTC. Internal WT amplicon: 1349 bp. Deletion size: 448 bp. Deletion left flank: AAATGTGTGCTCAGTTTTTGTTTGCGAAAA. Deletion right flank: TATCAGGTTTGTAGATCACGTTTTCCACTA. Insertion Sequence: CCCTTTAAAAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T06C10.4, T06C10.6, T06C10.3, cTe154X.1. The gk1263 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: GATGGAGTCGGTGGTGTTCT. External right primer: ATTTTTCAACTGCGAGCGAT. Internal left primer: GCTGGCAGTATTCGGATGAT. Internal right primer: AAATTTGCCGAAACGTGAAC. Internal WT amplicon: 2806 bp. Deletion size: 1036 bp. Deletion left flank: ACAAAATAAACGAGTTTAAAAAAACATTCA. Deletion right flank: TAACAAGGTACAATGGTTCCTGTAGTACTC. Other lesions identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C40D2.4, Y102A11A.2. The gk1252 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: CATACCCAAAGGTCTGGTGG. External right primer: GCACAACCTGTGCATGTAGG. Internal left primer: CCACAGACCCGCTATTAAGG. Internal right primer: TTCCCAACACTTCAACGTCA. Internal WT amplicon: 1685 bp. Deletion size: 547 bp. Deletion left flank: AAATTGCAATCGCTTCCGGTAAAATTACTT. Deletion right flank: GTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATA TGTATATGTATATGTATATGTATATGTATATGTATATGTTTATGTATATGTATATGTAT ATGTAAATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTATATGTA TATGTATATGTATATGTATATGCTGAAAGTCGA. The gk3151 allele was identifed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F45H11.6. External left primer: TCCTTATCGGGTGACTCCAG. External right primer: TAAGGCGCTGCTTTGATTTT. Internal left primer: GGACGGACACGTTTCAAATC. Internal right primer: TATTATTTGCCTGCTTCCGC. Internal WT amplicon: 1801 bp. Deletion size: 572 bp. Deletion left flank: GAAATATTTGAAGTAAAAATAATAATACAT. Deletion right flank: TTGAATGCCAGTTTTAAGGCACACACTGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C49C3.13, W03G11.3. The gk1251 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: AATGGAAAACGTTTGAACTTTGTAG. External right primer: AATTCAATCCATCATTTTCTGTGTT. Internal left primer: CATTGCCAAAAGGTGTCATAAA. Internal right primer: CCATCTTGGTACGATGACTCAA. Internal WT amplicon: 2027 bp. Deletion size: 969 bp. Deletion left flank: TATGATACAATGACTAAATATCGTAATCAG. Deletion right flank: TCCCCAATGACAGAATATGCCAAACTTTGA. The gk3149 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807