| WH528 |
C. elegans |
cgef-1(gk261) X; ojIs26. Show Description
ojIs26 [GFP::nmy-2 + unc-119(+)]. Maintain under normal conditions. Reference: Kumfer et al. (2010) Mol Bio Cell21(2):266-77.
|
|
| WH529 |
C. elegans |
cgef-1(gk261) X; ddIs?. Show Description
ddIs? [pie-1p::GFP::par-6 + unc-119(+)]. Reference: Kumfer et al. (2010) Mol Bio Cell21(2):266-77.
|
|
| WH530 |
C. elegans |
cgef-1(gk261) X; itIs153. Show Description
itIs153 [pie-1p::par-2::GFP + rol-6(su1006) + N2 genomic DNA]. Maintain at 24 degrees; sick at 25 C, GFP lost at 20C. itIs153 is an integrated derivitive of axEx1094. Reference: Kumfer et al. (2010) Mol Bio Cell21(2):266-77.
|
|
| WHY430 |
C. elegans |
attf-6(how51[GFP::TEV::AID::attf-6]) I; wrdSi51 II. Show Description
wrdSi51 [mex-5p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). GFP::TEV::AID tag inserted at the N-terminus of the endogenous attf-6 locus facilitates auxin-inducible degradation of GFP::TEV::AID::ATTF-6. Reference: Wang Y, et al. Nucleic Acids Research. 2025 Feb 28; 53(4): gkaf079. doi: 10.1093/nar/gkaf079 PMID: 39945323.
|
|
| WHY546 |
C. elegans |
WHY546 attf-6(how52[attf-6::3xflag]) I. Show Description
3xFlag tag inserted at the C-terminus of the endogenous attf-6 locus. Reference: Wang Y, et al. Nucleic Acids Research. 2025 Feb 28; 53(4): gkaf079. doi: 10.1093/nar/gkaf079 PMID: 39945323.
|
|
| WJA2119 |
C. elegans |
znf-598(srf2119) II. Show Description
srf2119 is a 965bp deletion within znf-598. Reference: Monem PC et al. PLOS Genet. 2023 Jan 10;19(1):e1010577. doi: 10.1371/journal.pgen.1010577. PMID: 36626369
|
|
| WS4274 |
C. elegans |
unc-119(ed3) III; opIs206. Show Description
opIs206 [hif-1p::hif-1(genomic)::GFP::hif-1 3'UTR + unc-119(+)]. Weak GFP signal in early embryonic stages (2-cell, 4-cell, 8-cell, etc.). Reference: Sendoel A, et al. Nature. 2010 Jun 3;465(7298):577-83.
|
|
| WU1563 |
C. elegans |
hizr-1(am285) X. Show Description
Gain-of-function allele: modified ligand binding domain constitutively binds HZA element. High zinc transcriptional activation - constitutive (Zad-c). [NOTE: this strain was previously described as hizr-1(am286); the correct allele name hizr-1(am285).] Reference: Warnhoff K, et al. PLoS Biol. 2017 Jan 17;15(1):e2000094.
|
|
| WU209 |
C. elegans |
cdf-1(n2527) X. Show Description
Severe loss of function/null. Weak vulvaless phenotype (subtle defect in vulval cell lineages). Nonsense change of codon 186 of the predicted ORF C15B12.7. See also WBPaper00005255.
|
|
| WX1257 |
C. elegans |
dyf-3(og22) IV; ogEx49. Show Description
ogEx49 [dyf-3(+) + rol-6(su1006)]. Maintain by picking Rollers. Animals which have lost the array are Dyf (DiI).
|
|
| WX737 |
C. elegans |
dyf-3(og22) IV. Show Description
Dyf (DiI), chemotaxis defective towards IAA. Preliminary results show increased longevity.
|
|
| XA3101 |
C. elegans |
paf-1(tj11) I. Show Description
Superficially WT.
|
|
| XA3102 |
C. elegans |
paf-2(tj12)/lon-2(e678) X. Show Description
Heterozygotes are WT and segregate WT, Lon and dead eggs. Maintain by picking WT.
|
|
| XA8106 |
C. elegans |
hcf-1(pk924) IV. Show Description
Pleiotropic defects including reduced broodsize, reduced levels of histone H3 serine 10 phosphorylation, cold-sensitive embryonic lethality, cold-sensitive early embryonic mitotic and cytokinetic defects. Reference: Lee S, et al. PLoS One. 2007 Nov 28;2(11):e1213.
|
|
| XE1024 |
C. elegans |
daf-2(e1370) III; oxIs12 X. Show Description
oxIs12 [unc-47p::GFP] X. GFP expression in GABA neurons. Higher axon regeneration in aged animals. Reference: Byrne AB, et al. Neuron. 2014; 81(3):561-73.
|
|
| XE1203 |
C.elegans |
sup-17(n316) zdIs5 I. Show Description
zdIs5 [mec-4p::GFP + lin-15(+)] I. Axon regeneration is significantly improved in ADAM10/sup-17(n316) loss-of-function mutants. Reference: El Bejjani R & Hammarlund M. Neuron. 2012 Jan 26;73(2):268-78. doi: 10.1016/j.neuron.2011.11.017. PMID: 22284182.
|
|
| XE1593 |
C. elegans |
daf-16(mu86) I; wpSi14 II; daf-2(e1370) III. Show Description
wpSi14 [rgef-1p::GFP::daf-16A + Cbr-unc-119(+)] II. Reference: Byrne AB, et al. Neuron. 2014 Feb 5;81(3):561-73.
doi: 10.1016/j.neuron.2013.11.019. PMID: 24440228
|
|
| XE2411 |
C. elegans |
unc-116(rh24sb79) III; oyIs14 V. Show Description
oyIs14 [sra-6p::GFP + lin-15(+)]. Disrupted mitochondrial trafficking. sb79 is an intragenic suppressor of the rh24 gain-of-function allele. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. PMID: 35285800.
|
|
| XIL9122 |
C. elegans |
ztf-14(thu120[ztf-14::2A::H1::mCherry]) X. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous ztf-14 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
|
|
| XIL9136 |
C. elegans |
ztf-7(thu136[ztf-7::2A::H1::mCherry]) V. Show Description
2A::H1::mCherry was inserted at the 3' end of the endogenous ztf-7 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
|
|
| XIL9164 |
C. elegans |
daf-3(thu164[daf-3::SL2::mCherry::H2B]) X. Show Description
SL2::mCherry::H2B was inserted at the 3' end of the endogenous daf-3 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.
|
|
| XMN1253 |
C. elegans |
daf-15(bgg95) IV. Show Description
Maintain at 20C for best fecundity and most rapid development. Variable temperature-sensitive phenotypes. 20C: wild type; 22C: hypoxia resistant and long lifespan; 25C fully penetrant L3 developmental arrest. daf-15(bgg95) is an engineered I1033K missense mutation that also introduced three silent wobble mutations in nearby bases affecting restriction sites (cagGTTGCCCGAATGGCTCAAAAAATAGTGCAT -> cagGTGGCACGGATGGCTCAAAAAAAAGTGCAT). Strain can be genotyped by digest with either Bcc1 (silent wobble mutation generates additional cut in bgg95) or with Bgl1 (silent wobble mutation eliminates cut in bgg95). daf-15 crRNA: aucucgucagguugcccgaa. Repair ssODN: CATTTCGGGCATTCCTGCTTCGACGCGATGCACTTTTTTTTGAGCCATCCGTGCCACCTGACGAGATGTATTGGTTGTATTACACAGAC. Reference: Sun CL, et al. Curr Biol. 2025 Jun 9;35(11):2567-2582.e5. doi: 10.1016/j.cub.2025.04.040. PMID: 40339571.
|
|
| XZ2056 |
C. elegans |
hif-1(ia4) V; yakEx126. Show Description
yakEx126 [unc-17p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from cholinergic neuron-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx126 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
|
|
| XZ2065 |
C. elegans |
hif-1(ia4) V; yakEx131. Show Description
yakEx131 [eft-3p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from a ubiquitous promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx131 rescues lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
|
|
| XZ2073 |
C. elegans |
hif-1(ia4) V; yakEx137. Show Description
yakEx137 [unc-14p::hif-1(P621A)::YFP + myo-2p::mCherry]. Pick animals with red pharynx to maintain. Non-degradable form of HIF-1 tagged with YFP expressed from unc-14 promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx137 rescues lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
|
|
| XZ2074 |
C. elegans |
hif-1(ia4) V; yakEx136. Show Description
yakEx136 [vha-6p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from intestine-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx136 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
|
|
| XZ2080 |
C. elegans |
yakEx142. Show Description
yakEx142 [unc-14p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. unc-14 promoter drives GFP expression in several tissues including neurons, intestine, muscle, hypodermis. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
|
|
| XZ2081 |
C. elegans |
hif-1(ia4) V; yakEx143. Show Description
yakEx143 [dpy-7p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from a hypodermal-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx143 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
|
|
| XZ2082 |
C. elegans |
hif-1(ia4) V; yakEx144. Show Description
yakEx144 [unc-14p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from unc-14 promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx144 rescues lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
|
|
| XZ2083 |
C. elegans |
hif-1(ia4) V; yakEx145. Show Description
yakEx145 [unc-47p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from GABA-ergic neuron-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx145 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
|
|
| XZ2084 |
C. elegans |
hif-1(ia4) V; yakEx125. Show Description
yakEx125 [rab-3p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from pan-neuronal-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. yakEx125 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
|
|
| XZ2085 |
C. elegans |
hif-1(ia4) V; yakEx146. Show Description
yakEx146 [vha-6p::hif-1(cDNA) + dpy-7p::hif-1(cDNA) + rab-3p::hif-1(cDNA) + myo-2p::mCherry]. Pick animals with red pharynx to maintain. HIF-1 expressed from pan-neuronal-, hypodermal-, and intestinal-specific promoters in hif-1 mutant background for tissue-specific rescuing experiments. yakEx146 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
|
|
| YG1007 |
C. elegans |
baf-1(gk324) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); syIs50. Show Description
syIs50 [cdh-3::GFP + dpy-20(+)]. Heterozygotes are WT and GFP+, and segregate arrested hT2 aneuploids, non-GFP gk324 homozygotes (Sterile and Unc). All worms express cdh-3::GFP at the anchor cell. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.
|
|
| YG1011 |
C. elegans |
baf-1(gk324) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); qIs19 V. Show Description
qIs19 [lag-2p::GFP::unc-54 3'UTR + rol-6(su1006)] V. Heterozygotes are Rollers with pharyngeal GFP signal, and segregate arrested hT2 aneuploids, and non-GFP gk324 homozygotes (Sterile and Unc). All worms express lag-2p::GFP at the distal tip cells. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.
|
|
| YG1017 |
C. elegans |
baf-1(gk324) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); syIs78. Show Description
syIs78 [ajm-1::GFP + unc-119(+)] is probably on LG I (not on II, III, V or X). Heterozygotes are WT and GFP+, and segregate arrested hT2 aneuploids, non-GFP gk324 homozygotes (Sterile, Roller and Unc). All worms express ajm-1::GFP (Junction Associated Protein). qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.
|
|
| YG1021 |
C. elegans |
baf-1(gk324) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); ccIs4810 X. Show Description
ccIs4810 [(pJKL380.4) lmn-1p::lmn-1::GFP::lmn-1 3'utr + (pMH86) dpy-20(+)] X. Heterozygotes are WT with pharyngeal GFP signal, and segregate arrested hT2 aneuploids, non-GFP gk324 homozygotes (Sterile and Unc). All worms express Cel-lamin::GFP (lmn-1 gene is expressed at the nuclear periphery). qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.
|
|
| YG1036 |
C. elegans |
baf-1(gk324) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); zzIs16. Show Description
zzIs16 [(pJE3) eff-1::GFP + rol-6(su1006)]. Heterozygotes are Rollers with pharyngeal GFP signal, and segregate arrested hT2 aneuploids, and non-GFP gk324 homozygotes (Sterile, Roller and Unc). All worms express GFP driven by eff-1 promoter. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.
|
|
| YG1046 |
C. elegans |
baf-1(gk324) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); eff-1(ok1021) II; syIs78. Show Description
syIs78 [ajm-1::GFP + unc-119(+)] is probably on LG I (not on II, III, V or X). Heterozygotes are slow-growing DpyUnc with cell fusion problems and pharyngeal GFP signal. Segregates arrested hT2 aneuploids, and non-GFP DpyUnc gk324 homozygotes (Sterile, Dpy and Unc). All worms express ajm-1::GFP(Junction Associated Protein). qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.
|
|
| YH461 |
C. elegans |
ifta-2(tm1724) IV. Show Description
Extended life span. daf-d.
|
|
| YL195 |
C. elegans |
pzf-1(vr3) V. Show Description
Superficially wild type.
|
|
| YL585 |
C. elegans |
oef-1(vr25) IV. Show Description
vr25 is a Crispr/Cas9-induced 56 bp deletion in exon 2 of oef-1/F49E8.2 causing a frameshift and presumptive null allele. Accelerated rate of germ cell progression, precocious Z2/Z3 division in L1s, increased brood size and sperm generation, and increased germline apoptosis. Reference: McManus, CE & Reinke, V. Genetics. 2017; https://doi.org/10.1534/genetics.117.1123.
|
|
| YT17 |
C. elegans |
crh-1(tz2) III. Show Description
Clumpy, pale and slightly small, tend to dig into plate. Daf-c at 27C. Do not distribute this strain; other labs should request it from the CGC.
|
|
| YY13 |
C. elegans |
rrf-3(mg373) II; oxls12. Show Description
oxls12 [unc-47p::GFP + lin-15(+)]. Enhanced RNAi. Sterile at 25 degrees. [NOTE: the genotype of YY13 as previously annotated only as rrf-3(mg373)] References: Pavelec DM, et al. Genetics. 2009 Dec;183(4):1283-95. PMID: 19797044. McIntire SL, et al. Nature. 1997 Oct 23;389(6653):870-6. PMID: 9349821.
|
|
| ZD1258 |
C. elegans |
eif-3.L(qd310) II. Show Description
C17G10.9 Increased lifespan and enhanced resistance to endoplasmic reticulum (ER) stress, independent of IRE-1-XBP-1, ATF-6, and PEK-1. Reference: Cattie DJ, et al. PLoS Genet. 2016 Sep 30;12(9):e1006326.
|
|
| ZD1866 |
C. elegans |
eif-2a(qd338) I. Show Description
Y37E3.10. qd338 disrupts Ser49 phosphorylation site; suppresses daf-28(sa191) constitutive dauer entry phenotype. Reference: Kulalert W, et al. Genetics 2017. In press.
|
|
| ZD2005 |
C. elegans |
eif-2Ba(qd335) III. Show Description
ZK1098.4. qd335 suppresses daf-28(sa191) constitutive dauer entry phenotype. Reference: Kulalert W, et al. Genetics 2017. In press.
|
|
| ZD318 |
C. elegans |
agIs219 atf-7(qd22qd130) III. Show Description
agIs219 [T24B8.5p::GFP::unc-54-3' UTR + ttx-3p::GFP::unc-54-3' UTR] III. qd130 suppresses increased pathogen susceptibiliy (Esp) of atf-7(qd22). References: Shivers RP, et al. PLoS Genet. 2010 Apr 1;6(4):e1000892.
|
|
| ZD326 |
C. elegans |
agIs219 atf-7(qd22qd130) III; pmk-1(km25) IV. Show Description
agIs219 [T24B8.5p::GFP::unc-54-3' UTR + ttx-3p::GFP::unc-54-3' UTR] III. atf-7(qd22 qd130) suppresses increased pathogen susceptibiliy (Esp) of pmk-1(km25). References: Shivers RP, et al. PLoS Genet. 2010 Apr 1;6(4):e1000892.
|
|
| ZD340 |
C. elegans |
agIs219 atf-7(qd22qd130) III; sek-1(km4) X. Show Description
agIs219 [T24B8.5p::GFP::unc-54-3' UTR + ttx-3p::GFP::unc-54-3' UTR] III. atf-7(qd22 qd130) suppresses increased pathogen susceptibiliy (Esp) of sek-1(km4). References: Shivers RP, et al. PLoS Genet. 2010 Apr 1;6(4):e1000892.
|
|
| ZD442 |
C. elegans |
agIs219 atf-7(qd22) III. Show Description
agIs219 [T24B8.5p::GFP::unc-54-3' UTR + ttx-3p::GFP::unc-54-3' UTR] III. Enhanced susceptibility to pathogens. References: Shivers RP, et al. PLoS Genet. 2010 Apr 1;6(4):e1000892. Shivers RP, et al. Cell Host Microbe. 2009 Oct 22;6(4):321-30.
|
|