More Fields
Strain Species Genotype
VC1186 C. elegans haf-3(gk549) V. Show Description
F57A10.3. Superficially wild type. External left primer: AACCGGTTCTTGTCCAACTG. External right primer: CTACACCTCCCTGGCAATGT. Internal left primer: ACGACGCCAATATGATGGAT. Internal right primer: GAACGTCTTTCTTCCGTTCG. Internal WT amplicon: 1973 bp. Deletion size: 1141 bp. Deletion left flank: TTTTTTAATAAGTTTAATCACATTTTTCGG. Deletion right flank: GTAATTTCTCTTTTTTTTTAAAAAGACTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4413 C. elegans R02F11.3(gk5491[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 2082 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AATTCAAAAATTCCAGCAATTCAACCGTAC. Right flanking sequence: AGCCGGTGCTATTGTGGTTTCTATGTACAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4414 C. elegans egl-17(gk5492[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 2375 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CCGCTGTGAAAATCGTTTTACAGGCATCCA. Right flanking sequence: ATTTGTCCATCATGCAGTTCGTTCAAATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4416 C. elegans cest-31(gk5494[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 2081 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CCACTTCTGAATGTTTTAAACTCGACATGC; Right flanking sequence: AATCTCTCCTCTCGTGTTTTGAAAATTTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4419 C. elegans C16C8.20(gk5497[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 1076 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTTTTAGAGAGTTTTTTCTCGAATTTACCT; Right flanking sequence: CGGCAGTTTGCGAATAAATAATTGTGAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4420 C. elegans C15A11.2(gk5498[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 1162 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GGTAGGCAGGCGAATTTTTATGTGCCTCCT; Right flanking sequence: CTGTTTTTGCATGCGAAATAGTTATTTTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.