Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
EG9885 C. elegans W01A8.6(oxTi1120) I; unc-119(ox819) III. Show Description
oxTi1120 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + lox2272] I. Inserted into W01A8.6. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EG9887 C. elegans W01A8.6(oxTi1128) I; unc-119(ox819) III. Show Description
oxTi1128 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272]) I. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Inserted into W01A8.6. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EG9888 C. elegans W01A8.6(oxTi1128) I. Show Description
oxTi1128 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272]) I. Outcrossed to remove unc-119 mutation. Superficially wild-type. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Inserted into W01A8.6. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EG9891 C. elegans unc-119(ox819) III; W03F9.11(oxTi1121) V. Show Description
oxTi1121 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + lox2272]) V. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Inserted into W03F9.11. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EJ1167 C. elegans gem-1(bc364) X. Show Description
bc364 deletes 1,109 bp between AACATCTTGAATAACCATTCGGGAAGT and AAGTCATTCATTGCAGAGCTTACATTTAGTA. References: Kemp BJ, et al. Genetics. 2009 Feb;181(2):581-91.
EJ1171 C. elegans gon-2(q388) I; gem-1(bc364) X. Show Description
NOTE: Supplement media to 50 mM Mg2+ and grow at 15C for maximum fertility. The stock will propagate on non-supplemented media at 20 degrees, but this will potentially select for intragenic revertants of gon-2(q388). Temperature-sensitive failure of gonad precursor divisions. Penetrance of Gon phenotype is very high at 23.5C. At 25 degrees you can expect reduced brood sizes and some embryonic lethality. [Note: temperature sensitive period for gon-2(q388) begins prior to fertilization.] bc364 deletes 1,109 bp between AACATCTTGAATAACCATTCGGGAAGT and AAGTCATTCATTGCAGAGCTTACATTTAGTA. References: Kemp BJ, et al. Genetics. 2009 Feb;181(2):581-91. Sun AY & Lambie EJ. Genetics. 1997 Nov;147(3):1077-89.
EL301 C. elegans lag-1(om13) IV. Show Description
Temperature sensitive; best grown at 15C. Lab and embryonic Mel phenotypes.
EL477 C. elegans iffb-1(bc367)/sC1 [dpy-1(s2170)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy sC1 homozygotes, and bc367 homozygotes which arrest as late L1/early L2 larvae (survive for a few days, then die).
EL597 C. elegans omIs1 II; met-2(n4256) unc-119(ed3) III. Show Description
omIs1 [met-2p::met-2::GFP + Cbr-unc-119(+)] II. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
EL602 C. elegans cid-1&pup-2(om129)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+, and non-GFP om129 homozygotes (reduced fertility, maternal effect embryonic lethality, and high incidence of male offspring). om129 homozygote defects become more severe over successive generations and are more severe at 25C. om129 is a CRISPR-engineered deletion completely removing cid-1 and pup-2 loci. cid-1 also known as pup-1. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539. Superficially wildtype strain expresses GFP in the pharynx and segregates GFP+ dumpy sterile qC1 homozygotes and homozygous pup-1/-2(om129) animals that have reduced fertility and maternal effect embryonic lethality and are Him. Phenotype becomes more severe over successive generations and is more severe at 25°C. Reference: Li Y, et al. Development. 2018 Oct 10;145(19):dev165944. doi: 10.1242/dev.165944. PMID: 30305273.
EL610 C. elegans smrc-1(om143[3xflag::smrc-1]) III. Show Description
3xFlag tag inserted at N-terminus of endogenous smrc-1 locus using Crispr/Cas9. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
EL630 C. elegans smrc-1(om138)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+, and non-GFP om138 homozygotes (reduced fertility, reduced embryonic viability and a high proportion of male offspring). om138 is a frameshift mutation. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
EL632 C. elegans smrc-1(om138) met-2(n4256)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+, and non-GFP non-GFP smrc-1(om138) met-2(n4256) homozygotes (reduced fertility, reduced embryonic lethality, and produce a high frequency of male offspring). These phenotypes are more severe at 25C, and at 25C the subsequent M-Z- generation produces essentially no viable embryos. The smrc-1(om138) allele was generated with CRISPR/Cas9 on the met-2(n4256) chromosome. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
EL634 C. elegans met-2(om142 [3xflag::met-2]) III. Show Description
3xFlag tag inserted at N-terminus of endogenous met-2 locus using Crispr/Cas9. Reference: Mutlu B, et al. Sci Adv. 2018 Aug 22;4(8):eaat6224. doi: 10.1126/sciadv.aat6224. PMID: 30140741.
EL658 C. elegans smrc-1(om138) met-2(om142[3xflag::met-2])/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+, and non-GFP smrc-1(om138) met-2(om142) homozygotes (reduced fertility, reduced embryonic viability and high incidence of male offspring). Defects are more prominent in M-Z- animals at 25C. 3xFlag tag inserted at N-terminus of endogenous met-2 locus using Crispr/Cas9. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
EL663 C. elegans smrc-1(om144[3xmyc::smrc-1]) met-2(om142[3xflag::met-2]) III. Show Description
3xmyc tag inserted at N-terminus of endogenous smrc-1 locus using Crispr/Cas9. 3xFlag tag inserted at N-terminus of endogenous met-2 locus using Crispr/Cas9. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
EL680 C. elegans smrc-1(q136)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+, and non-GFP q136 homozygotes (reduced fertility, reduced embryonic viability, and increased frequency of male offspring). q136 is a nonsense mutation. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
EL732 C. elegans smrc-1(om145[3xmyc::smrc-1]) III. Show Description
3xmyc tag inserted at N-terminus of endogenous smrc-1 locus using Crispr/Cas9. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.
EM105 C. elegans mab-21(bx41) III; him-5(e1490) V. Show Description
Transformation of ray 6 to a thin ray which is anteriorly displaced and fuses with ray 4 (95%). A 10th ray is found in about 50% of the sides scored. Body is slightly shorter.
EM111 C. elegans him-5(e1490) V; mab-19(bx38) X. Show Description
Male phenotype: loss of rays 7-9; incomplete penetrance/expressivity (80%); T lineage defect. Hermaphrodite phenotype: lowered brood size (100 progeny/hermaphrodite). Hypomorphic allele: uDf1/mab-19(bx38) results in embryonic arrest during morphogenesis.
EM116 C. elegans mab-25(bx27) I; him-5(e1490) V. Show Description
Temperature sensitive. Missing Ray. Swollen tail and reduced fan. Temperature sensitive lethal at all stages. Wrinkled spicule.
EM128 C. elegans mab-21(bx53) III; him-5(e1490) V. Show Description
Transformation of ray 6 to a thin ray which is anteriorly displaced and fuses with ray 4 (95%). A 10th ray is found in about 50% of the sides scored. Slightly shorter than WT. mab-21(bx53)/yDf10 is embryonically lethal with embryo arrest at 2 fold stage.
EM253 C. elegans mab-20(bx61) I; him-5(e1490) V. Show Description
Ray 3 and 4 fusion >60% at non-permissive temp. Ray 1 and 2 fusion about 10% at non-permissive temp. ts period is around L3-L4.
EM305 C. elegans efn-4(bx80) IV; him-5(e1490) V. Show Description
Extensive ray fusion involving all 9 rays. Larva have Vab phenotype with decreasing expressivity in adult. Hermaphrodites have swollen tail and anus. bx80 pka mab-26(bx80).
EM331 C. elegans him-5(e1490) V; mab-19(bx83) X. Show Description
Male phenotype: loss of rays 7-9; incomplete penetrance/expressivity (80%); T lineage defect. Hermaphrodite phenotype: lowered brood size (100 progeny/hermaphrodite). Hypomorphic allele: uDf1/mab-19(bx83) results in embryonic arrest during morphogenesis.
EM599 C. elegans him-5(e1490) V; lin-15B&lin-15A(n765) X; bxIs13. Show Description
bxIs13 [egl-5::GFP + lin-15(+)]. Him. egl-5::GFP reporter made from EM#286 (GFP inserted within the last few amino acids of the C-terminus) by integrating bxEx30 in EM588. High nuclear expression of transgene in males (good in seam cells, none in rectal epithelium), weak expression in hermaphrodites. Expression in 2-4 head neurons in males and hermaphrodites. egl-5 gene on reporter does not rescue egl-5(-).
EM62 C. elegans mab-17(e2167) unc-15(e73) I; him-5(e1490) V. Show Description
Unc. Round bulging adult male tale. Very reduced fan. Mating efficiency is zero.
EM66 C. elegans him-5(e1490) V; vab-3(bx23) X. Show Description
Transformation of ray 6 to a thin ray which is anteriorly displaced and fuses with ray 4 (99%). Body is slightly shorter. See also WBPaper00002235.
EM67 C. elegans mab-20(bx24) I; him-5(e1490) V. Show Description
Extensive ray fusion. Posterior portion of body swollen at larval stages.
EN909 C. elegans krIs14 V. Show Description
krIs14 [hsp-16.48p::MosTransposase + lin-15B + unc-122p::GFP]. GFP expression in coelomocytes. Derived by integration of oxEx166. Reference: Toraason E, et al. STAR Protoc. 2021 Sep 8;2(3):100801. doi: 10.1016/j.xpro.2021.100801. PMID: 34527958.
ENL63 C. elegans daf-16(mgDf47) I; sma-10(ok2224) IV; xrIs87. Show Description
xrIs87 [daf-16(alpha)::GFP::daf-16B + rol-6(su1006)]. Rollers. Derived from RB1739 and GR1352.
ENL68 C. elegans sma-10(ok2224) zIs356 IV. Show Description
zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)]. See strain TJ356 for additional information about zIs356. Derived from RB1739 and TJ356.
ESC351 C. elegans rpoa-2(cse319[AID*::GFP::rpoa-2]) I; reSi2 II. Show Description
reSi2 [col-10p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Maintain at 15-20C. AID* and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in hypodermis. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
ESC440 C. elegans reSi2 II; tsr-2(cse424[tsr-2::degron::GFP]) IV. Show Description
Maintain at 15-20C. reSi2 [col-10p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Hypodermal-specific expression of TIR1 co-factor for AID. degron::GFP tag inserted into the C-terminus of endogenous tsr-2 locus. This strain can be used for auxin-inducible degradation (AID) of TSR-2 in epidermal tissues. Nucleolar GFP expression. Reference: Zhao Q., et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
ESC444 C. elegans reSi2 II; grwd-1(cse432[grwd-1::degron::GFP]) III. Show Description
Maintain at 15-20C. reSi2 [col-10p::TIR1::F2A::mTagBFP2::AID*::NLS::tbb-2 3'UTR] (II:0.77). Hypodermal-specific expression of TIR1 co-factor for AID. degron::GFP tag inserted into the C-terminus of endogenous tsr-2 locus. This strain can be used for auxin-inducible degradation (AID) of GRWD-1 in epidermal tissues. Nuclear GFP expression. Reference: Zhao Q., et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.
ESK6 C. elegans unc-119(ed3) III; aak-2(ok524) X; fphIs3. Show Description
fphIs3 [rab-3p::aak-2A::GFP + unc-119(+)]. aak-2A isoform expressed from the neuronal rab-3 promoter in aak-2(ok524) background. Reference: Jeong JH, et al. Nat Commun. 2023 Jan 18;14(1):288. doi: 10.1038/s41467-023-35952-z. PMID: 36653384.
ET113 C. elegans unc-119(ed3) III; ekIs2. Show Description
ekIs2 contains [pie-1p::GFP::cyb-1 + unc-119(+)]. Translational fusion of CYB-1 expressed from the pie-1 promoter and including the pie-1 3'UTR. GFP::CYB-1 expression in the proximal gonad, with staining disappearing in the zygote. Maintain at 25°C.
ET263 C. elegans ddb-1(tm1769)/dpy-20(e2017) IV. Show Description
Heterozygotes are WT and segregate WT, Dpy and ddb-1 homozygotes, which arrest as L2-stage larvae (approx. 15%) or become sterile adults with protruding vulva (approx. 85%).
EU1068 C. elegans unc-119(ed3) ruIs32 III; repo-1 (or430) IV; ruIs57. Show Description
ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. Maintain at 15C. Temperature-sensitive embryonic-lethal at restrictive temperature of 26C; viable at permissive temperature of 15C. Reversed AP polarity axis at restrictive temperature with his-11::GFP and tubulin::GFP expression. Reference: Keikhaee MR, et al. PLoS One. 2014 Sep 4;9(9):e106484.
EU1133 C. elegans apo-5(or358) ruIs32 III Show Description
ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. apo-5(or358) is temperature-sensitive embryonic lethal. 100% dead embryos when L4 larvae are shifted to 26.6C. A small percentage of embryos survive form L4 larvae shifted to 25-26C. or358 appears to be semi-dominant; L4 or358/+ heterozygotes shifted to 26C produce ~20% embryonic lethality. Maintain at 15C. References: Encalada SE, et al., Mol Biol Cell. 2005 Mar;16(3):1056-70. Strome S, et al. Mol Biol Cell. 2001 Jun;12(6):1751-64.
EU1472 C. elegans let-99(or204) IV; him-5(e1490) V. Show Description
let-99(or204) is temperature-sensitive, maternal-effect, embryonic-lethal. Nearly completely penetrance of lethality at 26C. Viable at 15C. Maintain at 15C. Reference: Goulding MB, et al. J Cell Biol. 2007 Sep 24;178(7):1177-91.
EU1588 C. elegans tbb-2(or600) III. Show Description
Semi-dominant. Temperature-sensitive embryonic lethal. Maintain at 15C. Reference: O'Rourke SM, et al. PLoS One. 2011 Mar 1;6(3):e16644.
EU1600 C. elegans aspm-1(or645); ltIs37 IV; ojIs1. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Temperature-sensitive. Viable at 15C. Complete loss of aspm-1 function at 26C. Shift to restrictive temperature for 3-6 hours to induce oocyte meiotic spindle phenotype and bypass sterility. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly A, et al. Mol Biol Cell. 2014 Apr;25(8):1298-311. PMID: 24554763
EU2695 C. elegans klp-7(or1292) III; ltIs37 IV; ojIs1. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Temperature-sensitive embryonic lethal. Maintain at 15C. Shift to 25-26C for 2-6 hours to induce meiotic spindle phenotype. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499
EU2697 C. elegans mei-1(or1178) I; ItIs37 IV; ojIs1. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Maintain at 15C; sterile at 26C. Shift to restrictive temperature (26C) for 3-6 hours to induce oocyte meiotic spindle phenotype and bypass sterility. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly A, et. al. Mol Biol Cell. 2014 Apr;25(8):1298-311.
EU2706 C. elegans unc-119(ed3) ruIs32 III; drp-1(or1393) IV. Show Description
ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. Embryonic lethal at 26C. Maintain at 15C. Temperature-sensitive embryonic lethal following L4 upshift; germline defective following L1 upshift. Reference: Lowry J, et al. G3 (Bethesda). 2015 Aug 26;5(11):2241-55.
EU2711 C. elegans ndg-4(or1565) unc-119(ed3) ruIs32 III; ojIs1. Show Description
ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Embryonic lethal at 26C. Maintain at 15C. Temperature-sensitive embryonic lethal following L4 upshift; germline defective following L1 upshift. Reference: Lowry J, et al. G3 (Bethesda). 2015 Aug 26;5(11):2241-55.
EU2715 C. elegans klp-7(or1092) III; ltIs37 IV; ojIs1. Show Description
ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Temperature-sensitive embryonic lethal. Maintain at 15C. Shift to 25-26C for 2-6 hours to induce meiotic spindle phenotype. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499
EU2809 C. elegans ruIs32 III; klp-18(or447) IV. Show Description
ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. Temperature-sensitive. Viable at 15C. Complete loss of klp-18 function at 26C. Shift to restrictive temperature for 3-6 hours to induce oocyte meiotic spindle phenotype and bypass sterility. Reference: Connolly A, et al. Molecular Biology of Cell 2014. (In Press)
EU2858 C. elegans repo-1(or430) IV; itIs153; ojIs1. Show Description
itIs153 [pie-1p::par-2::GFP + rol-6(su1006) + N2 genomic DNA]. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Maintain at 15C. Temperature-sensitive embryonic-lethal at restrictive temperature of 26C; viable at permissive temperature of 15C. Reversed AP polarity axis at restrictive temperature with par-2::GFP and tubulin::GFP expression. itIs153 is an integrated derivitive of axEx1094. Reference: Keikhaee MR, et al. PLoS One. 2014 Sep 4;9(9):e106484.