| HS1680 |
C. elegans |
lin-44(n1792) zdIs5 I; cwn-1(ok546) II; egl-20(n585) cwn-2(ok895) IV/nT1 [qIs51] (IV;V); mom-2(ne874) V/nT1. Show Description
zdIs5 [mec-4p::GFP + lin-15(+)] I. Homozygous nT1[qIs51] are inviable. mec-4::GFP is expressed in touch neurons. Heterozygotes are strong Egl Psa GFP+ and segregate dead eggs and non-GFP Unc Egl Psa that give only dead eggs at 25C.
|
|
| HS2326 |
C. elegans |
cwn-1(ok546) II; egl-20(n585) cwn-2(ok895) IV/nT1 [qIs51] (IV;V); vpIs1 X. Show Description
vpIs1 [elt-3::GFP + lin-15(+)] X. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok546 homozygotes (Unc Egl). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Yamamoto Y, et al. PLoS Genet. 2011 Oct;7(10):e1002308.
|
|
| HS732 |
C. elegans |
wrm-1(tm514) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm514 homozygotes (probable embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain.
|
|
| JCP53 |
C. elegans |
dpy-11(e224) ccz-1(t2129) V/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ccz-1 homozygotes (produce only arrested embryos with spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.
|
|
| JEK1001 |
C. elegans |
ddx-15 (tm4014) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm4014 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. The tm4014 allele was provided by the National BioResource Project (NBRP, for C. elegans).
|
|
| JJ1079 |
C. elegans |
hmr-1(zu389)/lin-11(n566) unc-75(e950) I. Show Description
Heterozygotes are WT and segregate WT, Hmr inviable embyros and Egl Unc. Hmr: Hammerhead - defective hypodermal enclosure, especially in anterior regions; approximately 2% of zu389 embryos enclose normally and are Hmp [Humpback: defective body elongation, abnormal bulges on dorsal side]. See also WBPaper00005031. Received new stock from Allison Lynch in the Hardin lab 3/2009.
|
|
| JJ862 |
C. elegans |
hmp-1(zu278)/daf-11(m84) sma-1(e30) V. Show Description
Heterozygotes are WT and segregate WT, Hmp inviable embyros (Hmp: humpback-defective body elongation, abnormal bulges on dorsal side) and Daf Sma (ts Daf).
|
|
| JK2751 |
C. elegans |
sys-1(q544) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT. q544 is homozygous embryonic lethal. hT2[qIs48] homozygotes are inviable. PIck GFP+ wild-type to maintain. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Do not distribute this strain; other labs should request it from the CGC.
|
|
| JK3140 |
C. elegans |
gon-1(e2551) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+. Segregate Gon worms which are GFP-. nT1[qIs51] homozygotes are inviable. Do not distribute this strain; other labs should request it from the CGC.
|
|
| JK3221 |
C. elegans |
sys-1(q736) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT, but frequently sterile when balanced by hT2[qIs48]. q736 is homozygous embryonic lethal. (Approx. 5% of hets are Sterile when balanced by WT.) hT2[qIs48] homozygotes are inviable. q736 is a deletion of sys-1 deleting from nucleotide 1803 to nucleotide 3992 of the genomic sequence (A of start ATG is position 1). Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Do not distribute this strain; other labs should request it from the CGC.
|
|
| JK4177 |
C. elegans |
pup-3(q793) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q793 homozygotes (viable and somewhat fertile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
|
|
| JK4774 |
C. elegans |
lst-1(ok814) sygl-1(tm5040) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Kershner AM, et al. Proc Natl Acad Sci U S A. 2014 Mar 11;111(10):3739-44.
|
|
| JK4862 |
C. elegans |
glp-1(q46) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Austin J & Kimble J. Cell. 1987 Nov 20;51(4):589-99.
|
|
| JK4930 |
C. elegans |
lag-1(q426) IV/nT1[qIs51](IV; V). Show Description
Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP q426 homozygotes (variable phenotypes including sterile, L1 lethal, and small sterile adults with rectal protrusion and occasional bent pharynx). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Kadyk LC & Kimble J. Development. 1998 May;125(10):1803-13. doi: 10.1242/dev.125.10.1803. PMID: 9550713.
|
|
| JK5020 |
C. elegans |
glp-1(q172) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q172 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Crittenden SL, et al. Development. 1994 Oct;120(10):2901-11. doi: 10.1242/dev.120.10.2901. PMID: 7607080.
|
|
| JK5305 |
C. elegans |
lst-1(q827) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q827 homozygotes (viable and somewhat fertile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Robinson-Thiewes S, et al. G3 (Bethesda). 2022 Mar 4;12(3):jkab439. doi: 10.1093/g3journal/jkab439. PMID: 35100350.
|
|
| JK5796 |
C. elegans |
lst-1(q869) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q869 homozygotes (viable and somewhat fertile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. q869 is a deletion of the entire lst-1 coding sequence as well as 139 bp upstream of M71 start codon and 228 bp downstream of the coding sequence. Reference: Haupt KA, et al. Development. 2019 Oct 17;146(20):dev181644. doi: 10.1242/dev.181644. PMID: 31515205
|
|
| JK5986 |
C. elegans |
fbf-1(ok91) fbf-2(q1023[*q973])/mIn1[mIs14 dpy-10(e128)] II. Show Description
q1023 is an engineered Y479A point mutation in the R7/R8 loop of 3xFLAG-tagged FBF-2. Derived by modification of parental strain JK5935 fbf-2(q945[3xFLAG::fbf-2]) II. Pick GFP+ t maintain. Homozygous sterile (Mog) mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok91 q1023 homozygotes (sterile Mog). Pick WT dim GFP and check for correct segregation of progeny to maintain. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
|
|
| JK6059 |
C. elegans |
glp-1(q1035[*q1000]) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Pick GFP+ to maintain. CRISPR-engineered RAM mutations in endogenous glp-1 locus with C-terminal 4xV5 tag. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q1035 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock. Derived by modification of parental strain JK5933 glp-1(q1000).
|
|
| JK6321 |
C. elegans |
puf-3(q966) puf-11(q971) IV/ nT1[qIs51] (IV;V). Show Description
Homozygous maternal effect lethal double mutant balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested GFP+ nT1[qIs51] aneuploids, and non-GFP puf-3(q966) puf-11(q971) homozygotes (maternal effect lethal). Homozygous nT1[qIs51] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain.
|
|
| JK6401 |
C. elegans |
lst-1(q869) sygl-1(q828) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Pick GFP+ to maintain. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q869 q828 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock. Reference: Lynch TR, et al. Development. 2022 Apr 1;149(7):dev200332. PMID: 35394007.
|
|
| JK6516 |
C. elegans |
lst-1(q869) sygl-1(q1054) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Pick GFP+ to maintain. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q869 q1054 homozygotes (sterility/reduced fertility). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock. Reference: Lynch TR, et al. Development. 2022 Apr 1;149(7):dev200332. PMID: 35394007.
|
|
| JK6541 |
C. elegans |
gld-1(q1243) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Pick GFP+ to maintain. CRIPSR-engineered modification of gld-1 FBEa and FBEa* in gld-1 3'UTR. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q1243 homozygotes (sterility/reduced fertility). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock. Increase in distal GLD-1 protein levels and decrease in proximal GLD-1 protein levels. Qiu et al., in preparation.
|
|
| JK6600 |
C. elegans |
lst-1(q869) sygl-1(q1167) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Pick GFP+ to maintain. C-teminal V5 epitope tag inserted into endogenous sygl-1 locus that has a CRISPR-engineered mutation of predicted Notch-dependent cis-regulatory elementa LBS BCD (Yoo et al., 2004). Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q869 q1167 homozygotes (sterility/reduced fertility). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock. Reference: Lynch TR, et al. Development. 2022 Apr 1;149(7):dev200332. PMID: 35394007.
|
|
| JK6602 |
C. elegans |
gld-1(q1271[*q1242]) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Engineered TGT to ACA substitutions in FBEa1 and FBEb of the endogenous gld-1 locus with a downstream G to C substitution to facilitate screening by restriction digest. Pick GFP+ to maintain. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP q1271 homozygotes (sterile Mog). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived by modification of gld-1(q1242) homozygotes from parental strain JK6540. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.
|
|
| JK6721 |
C. elegans |
lst-1(q1086) sygl-1(q828) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Pick GFP+ to maintain. PUF-interacting motif B (PIM B) disrupted in endogenous lst-1 locus. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q1086 q828 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock.
|
|
| JK6722 |
C. elegans |
lst-1(q1124) sygl-1(q828) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Pick GFP+ to maintain. PUF-interacting motif A (PIM A) disrupted in endogenous lst-1 locus. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP q1124 q828 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Maintain by picking GFP+ heterozygotes and checking for correct segregation of progeny to maintain a balanced stock.
|
|
| JM130 |
C. elegans |
pho-1(ca101ca102) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozgyotes are WT and segregate WT, DpyUncs, and Unc Pho (slightly slow growing, about 15% shorter than WT and produce about 60% inviable embryos; early broods are less viable than later broods).
|
|
| JN215 |
C. elegans |
iff-1(tm483) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Segregates GFP+ glowing heterozygotes and non-glowing sterile iff-1 homozygotes. tm483 is a UV/TMP-induced iff-1 deletion allele generated by K. Gengyo-Ando and S. Mitani. hT2[qIs48] homozygotes inviable. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.
|
|
| JS604 |
C. elegans |
dpy-17(e164) tlk-1(tm2395) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and Dpy Stu homozygotes that are non-GFP. Homozygous hT2[bli-4 let-? qIs48] inviable.
|
|
| JVR406 |
C.elegans |
jerEx30. Show Description
jerEx30 [ddr-2p::BiFC1 (EGFH1-LINK-SYN) + tph-1p::BIFC2 (SYN-EGFH2) + rol-6(su1006)]. Pick Rollers to maintain. a-Synuclein BiFC transfer strain is a model to investigate neuron-to-neuron alpha-syn transfer. Reference: Tyson T, et al. Sci Rep. 2017 Aug 8;7(1):7506.
|
|
| KIR2 |
C. elegans |
capg-2(tm1833) V/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP capg-2 homozygotes (sick, sterile, Unc). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Csankovszki G, et al., Curr Biol. 2009 Jan 13;19(1):9-19.
|
|
| KR1949 |
C. elegans |
hIn1 I. Show Description
WT phenotype. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
|
|
| KR2151 |
C. elegans |
hIn1 [unc-54(h1040)] I. Show Description
Clear, paralyzed. Mutation is included in the hIn1 inversion. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
|
|
| KR292 |
C. elegans |
him-1(h55) dpy-5(e61) unc-13(e450) I; sDp2 (I;f). Show Description
sDp2 covers him-1 dpy-5. Pick Unc to maintain. Animals that lose the array are inviable.
|
|
| LG340 |
C. elegans |
skn-1(zu135) IV/nT1 [qIs51] (IV;V); geEx1. Show Description
geEx1 [gpa-4p::skn-1b::GFP + rol-6(su1006)]. Rollers. Pick Rolling GFP+ and check for correct segregation of progeny to maintain. skn-1 heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP skn-1 homozygotes (early arrest). Homozygous nT1[qIs51] inviable. Reference: Nature (2007) 447(7144):545-9.
|
|
| LG348 |
C. elegans |
skn-1(zu135) IV/nT1 [qIs51] (IV;V); geIs9. Show Description
geIs9 [gpa-4p::skn-1b::GFP + rol-6(su1006)]. Rollers. Heterozygotes are rollers with pharyngeal GFP signal, and segregate GFP+ rollers, arrested nT1[qIs51] aneuploids, and non-GFP skn-1 homozygotes (early arrest). Homozygous nT1[qIs51] inviable. Pick GFP+ rollers and check for correct segregation of progeny to maintain. skn-1 mutants are maternal-effect lethal and must be maintained as balanced heterozygotes. Reference: Bishop & Guarente, Nature (2007) 447(7144):545-9.
|
|
| LG357 |
C. elegans |
skn-1(zu135) IV/nT1 [qIs51] (IV;V); geIs10. Show Description
geIs10 [ges-1p(long)::skn-1c::GFP + rol-6(su1006)]. Rollers. Heterozygotes are rollers with pharyngeal GFP signal, and segregate GFP+ rollers, arrested nT1[qIs51] aneuploids, and non-GFP skn-1 homozygotes (early arrest). Homozygous nT1[qIs51] inviable. Pick GFP+ rollers and check for correct segregation of progeny to maintain. skn-1 mutants are maternal-effect lethal and must be maintained as balanced heterozygotes. Reference: Bishop & Guarente, Nature (2007) 447(7144):545-9.
|
|
| LW905 |
C. elegans |
lmn-1(tm1502) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm1502 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
|
|
| MLC2230 |
C. elegans |
vha-1(luc161) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP, arrested hT2 aneuploids, and non-GFP luc161 homozygotes (embryonic lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. vha-1(luc161) is a 454 bp deletion removing most of the coding sequence. Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
|
|
| MS662 |
C. elegans |
tbx-35(tm1789) II; irEx274. Show Description
irEx274 [ZK177 + unc-119::CFP + rol-6(su1006)]. Maintain by picking Rollers. Strain throws Rollers (expressing unc-119::CFP), dead eggs, and developmentally-arrrested L1s. Roller is often weak or not apparent. A greater proportion of tbx-35(tm1789) embryos will hatch as inviable L1s at 15C as compared with 20C or 25C.
|
|
| MT14171 |
C. elegans |
met-1(n4337) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); met-2(n4256) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
n4256 is a deletion of R05D3.11 (met-2). n4337 is a deletion of C43E11.3 from the splice donor for the 4th exon through exon 7. Heterozygotes are WT with pharyngeal GFP signal. Homozygous hT2[bli-4 let-? qIs48] are inviable.
|
|
| MT14533 |
C. elegans |
nDf50 nDf49/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous Emb deletion chromosome balanced by GFP and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP nDf50 nDf49 homozygotes (arrest as late embryos). Pick WT dim GFP and check for correct segregation of progeny to maintain. Reference: Curr Bio (2010) 20:367-73.
|
|
| MT14725 |
C. elegans |
sfa-1(n4562) IV/nT1 [qIs51] (IV;V). Show Description
Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP sfa-1 homozygotes (arrest L1-L2 stage). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Ma & Horvitz (2009) PLoS 5(11):e1000708.
|
|
| MT15107 |
C. elegans |
lin-53(n3368) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n3368 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.Class B SynMuv, Ste, Pvul. Reference: Harrison MM, Ceol CJ, Lu X, Horvitz HR. PNAS. 2006 Nov 7;103(45):16782-7.
|
|
| MT15606 |
C. elegans |
met-2(n4256) hpl-2(tm1489) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT and GFP+. qIs48 [myo-2::GFP + pes-10::GFP + ges-1::GFP]. Homozygous hT2 animals are inviable. May have lin-15A(n767) in background.
|
|
| MT18690 |
C. elegans |
sfa-1(n5223) IV/nT1 [qIs51] (IV;V). Show Description
Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP sfa-1 homozygotes (arrest L1-L2 stage). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Ma & Horvitz (2009) PLoS 5(11):e1000708.
|
|
| MT19085 |
C. elegans |
hlh-2(n5287) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n5287 homozygotes (embryonic lethal). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. n5287 is a 2,694 bp deletion (flanking seq 5' - TGCAACTGCCGCCATTGCTC 3' - AAAACTCTCTAGCATATTGT) and 25 bp insertion (TCTGCCATCATTGCTGCCATTGCTC). Reference: Nakano S, Ellis RE, Horvitz HR. Development. 2010 Dec;137(23):4017-27.
|
|
| MT3989 |
C. elegans |
clr-1(e1745) bli-2(e768) II. Show Description
Adult Blistered, especially in the head. Starved translucent appearance at 20c; inviable at 25C.
|
|
| MT5104 |
C. elegans |
lin-31(n301) clr-1(e1745) dpy-10(e128) II. Show Description
Dpy. Muv. Starved translucent appearance at 20c; inviable at 25C.
|
|