| Strain | Species | Genotype | Add |
|---|---|---|---|
| VC1610 | C. elegans | T08B2.5(gk721) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T08B2.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk721 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATTTGGTTGAGACGATCCG. External right primer: AAGGTAACATCGCCATCGAC. Internal left primer: CGTGACATGAGATCAGGCAT. Internal right primer: GCTTGTCAAACCTCACGGAT. Internal WT amplicon: 2344 bp. Deletion size: 914 bp. Deletion left flank: GGAATTGTCTACAGTGGATGTATGAACACT. Deletion right flank: GGTTGCCATCAAATTCAAATTTCCAGGGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1612 | C. elegans | nhr-283(gk735) V/nT1 [qIs51] (IV;V). Show Description
F57A10.6. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk735 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCACTAAAAGGCTGCAATG. External right primer: TTCGATTTTTATTTTGCGCC. Internal left primer: GTCGTGGCTCAATGAGGTTT. Internal right primer: CTCAAGTTAATCCCAGGCCA. Internal WT amplicon: 2348 bp. Deletion size: 1634 bp. Deletion left flank: TGAGGTGTAGATCTTCTGATACGTGGACAG. Deletion right flank: AATTTGAGGGTGCTTATGATTTTTGGTGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1621 | C. elegans | T26G10.1(ok2057) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
T26G10.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2057 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCACCATCAGCAATATCCA. External right primer: TCCGTTGGACTTTCCAATTC. Internal left primer: TTTTGTCGTCGCTTCTTTCC. Internal right primer: AAGTGTCGTCAGATTGCGTG. Internal WT amplicon: 2101 bp. Deletion size: 1183 bp. Deletion left flank: AGTCGGAAAATTCAAAATCTAACCTAAATT. Deletion right flank: CTCTGAAGACAATTAACCAGTTATTTCAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1622 | C. elegans | let-765(ok2058) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F20H11.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2058 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAATCGTATTGCTGCTTCCA. External right primer: CGGAGCTGGTGTAGGAAAAG. Internal left primer: GTCCATTCGAATCTTTCCGA. Internal right primer: TGCTGAACGTGATCTTCGAG. Internal WT amplicon: 3229 bp. Deletion size: 1540 bp. Deletion left flank: CACAGATTCTAGATGAAGTGATAAAATCCG. Deletion right flank: TTTTGAAGTTCTAAGACCATTCGTCCAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1630 | C. elegans | Y54E5A.2(ok2070)/hIn1 [unc-101(sy241)] I. Show Description
Y54E5A.2. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2070 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGTTTCGGTGTTGAGAGCGT. External right primer: TGGTGCATGATTTGTGGATT. Internal left primer: GCTCACAACTTCACGCAGAG. Internal right primer: TAAACACCAAGTGGCACCAA. Internal WT amplicon: 2168 bp. Deletion size: 1739 bp. Deletion left flank: AATTTCACGGGGTATATTTAATTTTTAATT. Deletion right flank: TTTTATCATGATATCTCAAAAGTTGAGTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1631 | C. elegans | dyf-3(gk760) IV/nT1 [qIs51] (IV;V). Show Description
C04C3.5. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk760 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACCACCCATCATGTTACCGT. External right primer: GAAGCTCGTCGACCGTAGTC. Internal left primer: TCACGCATCCTTCTTCTCCT. Internal right primer: TTGCAGGGAGTTTCTATGGG. Internal WT amplicon: 1853 bp. Deletion size: 736 bp. Deletion left flank: TACTCGTCCATATACTGAGGTCGGAAGGAC. Deletion right flank: CGGACCTCCTGCATCTGAACTTTCGACAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1632 | C. elegans | C17E4.6(gk787) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C17E4.6. Maternal effect lethal/sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk787 homozygotes (fertile WT whose progeny arrest before reproducing). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGTGTGTGAAGAGACGCAGA. External right primer: CCAACCCCAACTGCCTACTA. Internal left primer: AGAGCGCGTTTGCACTAATC. Internal right primer: GGAGCCATAGTCGAGAGACG. Internal WT amplicon: 2178 bp. Deletion size: 796 bp. Deletion left flank: AGAAGGAAGCTCCAATGACGAACATTCAAA. Deletion right flank: ACTGTTTTTGAAGAAACGTTTAAAAAAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1633 | C. elegans | unc-120(gk719) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
D1081.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk719 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CACTACCTTCACCCCTCCAA. External right primer: CTATAACACGGGACCCCCTT. Internal left primer: GGTCCTTCCATTCCCATCTT. Internal right primer: GGCTGACATAACATCGCTCA. Internal WT amplicon: 2150 bp. Deletion size: 972 bp. Deletion left flank: ATGTTTCTAAAATTTATCTGCATTTTCATA. Deletion right flank: AAATATCCTGACTCACCTATTTAGTTGCGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1635 | C. elegans | nono-1(gk1206) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F25B5.7. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1206 homozygotes (Unc, nearly Ste, has a few progeny but can't maintain population). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACCCCGTGACGAGATATCAG. External right primer: TCAAATTGCAACTCAACCCA. Internal left primer: AATCGGGAATTGGACACAAC. Internal right primer: TCGCATTATATCGCAGCTTG. Internal WT amplicon: 2308 bp. Deletion size: 1026 bp. Deletion left flank: ACTTCACAAATCAGTGGTTTCGGACTCCTA. Deletion right flank: AAAAGAAAACTCTAGAAGCTTCATAAATAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1636 | C. elegans | rsp-7&D2089.2(ok2079)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
D2089.1, D2089.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2079 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAAATTACGTCGCCGGTTTA. External right primer: CACTGTTTTTCGGAGCCAAT. Internal left primer: ACATTTCGACATCGGCTACC. Internal right primer: CACCTCAACTTATTCGGGGA. Internal WT amplicon: 3201 bp. Deletion size: 1429 bp. Deletion left flank: TAAGCCATTTCTCGAAGAAAACAAAGCACA. Deletion right flank: AGATCCAAAGATCGAAAGCGTGACAAGAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1638 | C. elegans | ZK1025.4(ok2101) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ZK1025.4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2101 homozygotes (sterile, lays unfertilized eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGTGCTGTTCGGGAAAAAT. External right primer: CAACTTTCCGGCTTGTAGGA. Internal left primer: TTTCCGGGTGAGTGAGTTTC. Internal right primer: GCGTCCGTGAAATTTGAGAT. Internal WT amplicon: 3284 bp. Deletion size: 1617 bp. Deletion left flank: TAAGCTTGGCGTCAGAGGCGAGCGTTAGCT. Deletion right flank: TTTCCGCCAGATCGGCAAATTTGCCGGAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1651 | C. elegans | C48A7.2(ok2116) IV/nT1 [qIs51] (IV;V). Show Description
C48A7.2. Apparent homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2116 homozygotes (arrest stage/phenotype undetermined). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTACGCCGGAAAGACAAAAA. External right primer: AAATCAATGAATGTGGGGGA. Internal left primer: TAAATGACGCCGAATTGTCA. Internal right primer: ATCGAAACTGCGCTGATCTT. Internal WT amplicon: 3253 bp. Deletion size: 1307 bp. Deletion left flank: TTGTTACAATAACTATGCAAATGTAAATAT. Deletion right flank: CCCCAAGATATAGTTTCGATAAGTAAATAC. Insertion Sequence: AT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1679 | C. elegans | efl-1(gk790) V/nT1 [qIs51] (IV;V). Show Description
Y102A5C.18. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk790 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. NOTE: Balancer is prone to breaking down. Pick WT GFP+ and check for correct segregation of progeny to maintain. External left primer: TGTCGTTTCCCTTCCTTCAC. External right primer: TAGGCACAGCTTGAACCCTT. Internal left primer: TGGAGCGAAATTGAGGCTAT. Internal right primer: CAGAAAGCTAAGACCTGCGG. Internal WT amplicon: 1986 bp. Deletion size: 671 bp. Deletion left flank: GTGTCAAAAATGAAATTTTCATATGAAAAT. Deletion right flank: CAAAGTCAAGCTCATTGTCGAGCCCGAGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1681 | C. elegans | F13H10.4(ok2135) IV/nT1 [qIs51] (IV;V). Show Description
F13H10.4. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2135 homozygotes (sterile, oftein with abnormal vulva). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGCATGGACTTGAGGATTGG. External right primer: AATGGTGCCATCTATCAGGC. Internal left primer: TGAGCATCATTGGGAACAAA. Internal right primer: ATAACTCAAAAAGCGCCGAA. Internal WT amplicon: 3344 bp. Deletion size: 1311 bp. Deletion left flank: TTGTATCTGTAATAAAATCGAAAAAGTAAT. Deletion right flank: GAGCATTACAGAATGAGAAGTTTGAAGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1684 | C. elegans | C34B2.8(ok2168) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C34B2.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2168 homozygotes (mid-larval arrest, thin Unc sometimes with withered tail). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTTTTCATTCCACCTTCGGA. External right primer: CATCTGCTCCAACGACTTCA. Internal left primer: AACAACCGCGTCAAAAGTGT. Internal right primer: ATTCGTCTCGATTTGCTGCT. Internal WT amplicon: 2130 bp. Deletion size: 1250 bp. Deletion left flank: GACCCACCGCTCAATTTTTGTTCCTGCGCC. Deletion right flank: TTGAATGCACGATAGCCTCCTTTTGGAGGC. Insertion Sequence: AAAAGTGCGATGGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1685 | C. elegans | cogc-1(ok2123) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y54E10A.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2123 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAAATTCGCCAAAAGGGTCT. External right primer: AGCAGAAGCTGGAGCACATT. Internal left primer: CTGACAATTTTTGGGCTCGT. Internal right primer: GCCATCGTTTCTTTGAGAGC. Internal WT amplicon: 3367 bp. Deletion size: approximately 1600 bp. Deletion extents narrowed to region between Y54E10A coordinates 80020 and 81877. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1687 | C. elegans | unc-39(gk798) V/nT1 [qIs51] (IV;V). Show Description
F56A12.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk798 homozygotes (embryonic or early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCGGAAATCATCATCCAAT. External right primer: CAGACAAGGATAGCACGCAA. Internal left primer: CCCATCCTCACCTCCTAACA. Internal right primer: TTTACGACTTGGCAGCTGGT. Internal WT amplicon: 2117 bp. Deletion size: 1032 bp. Deletion left flank: CGAGGGAAATCAAATATCAGAACTTGAAAA. Deletion right flank: TATCATTCCAATGAATTCGAGACACTCTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1704 | C. elegans | set-26&tsr-25(ok2136) IV/nT1 [qIs51] (IV;V). Show Description
Y51H4A.12 & Y51H4A.15. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2136 homozygotes (mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCCATTCCACCAATTCCA. External right primer: TTGAAAAATCGGCTTTCAGG. Internal left primer: ACTCCACTTGATTTCCACCG. Internal right primer: AAATTCCTCGCTTTTCGTCA. Internal WT amplicon: 2473 bp. Deletion size: 1621 bp. Deletion left flank: CTTCTGTCGGGAGAATGATTCGGTCCGCGG. Deletion right flank: CAAATATCCTGTATCACGATTTCGACCTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1705 | C. elegans | ehbp-1(ok2140) V/nT1 [qIs51] (IV;V). Show Description
F25B3.1. Homozygous lethal/sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2140 homozygotes (late larval or sterile adult arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTGGCAGCTGACTGATACA. External right primer: AACTTCTCACCCGTTGGATG. Internal left primer: AACCTACCGAGAGCGTGAGA. Internal right primer: GCTTTCCGTGAATTTGGTGT. Internal WT amplicon: 3312 bp. Deletion size: 1369 bp. Deletion left flank: AGGAACATCGAAAATCGAAAAAAAAATTCG. Deletion right flank: TACATAACTGAACATTTCCTACTACCATAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1706 | C. elegans | C38H2.2(ok2175) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C38H2.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2175 homozygotes (sterile, lays no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATGTGCTGGTGATATGGCAA. External right primer: GAAAAGGCACAGGGTGTGAT. Internal left primer: TCAGACAACCTACGACGCTG. Internal right primer: AGGGTGGAGAACAGTCATGG. Internal WT amplicon: 2946 bp. Deletion size: 767 bp. Deletion left flank: GCGAAGAAGGTTCGCGTCTTCTGTTGGATT. Deletion right flank: GGTAATTTCAGATTCATTGAAGTAGCGCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1710 | C. elegans | dsh-2(ok2164)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C27A2.6. Homozygous marginally viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2164 homozygotes (mostly sterile; eggs sometimes hatch into abnormal larvae that may grow to adult and reproduce). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAACCAGACCCACTGCTGAG. External right primer: GAAGCTTTGCTCCGTACGAC. Internal left primer: TTCCGTGAGGAAATGGAGAC. Internal right primer: AATTGACCTGACCTTGGCTG. Internal WT amplicon: 2756 bp. Deletion size: 1177 bp. Deletion left flank: CACACTCATCTCCCATGACGTAGTAGCATT. Deletion right flank: TGGAGATATAAAACCTTTATAAAGTTACCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1714 | C. elegans | unc-39(ok2137) V/nT1 [qIs51] (IV;V). Show Description
F56A12.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2137 homozygotes (probably most often early larval or embryonic arrest, but occasional homozygotes are seen that are Dpyish, Unc and arrest as mid-stage larvae). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCGGAAATCATCATCCAAT. External right primer: CAAAAGTCACGCGAATCTCA. Internal left primer: CCCATCCTCACCTCCTAACA. Internal right primer: GCGAAGGAGATTTTGAGCAC. Internal WT amplicon: 3042 bp. Deletion size: 1782 bp. Deletion left flank: TTTTTAAAAACATGTTCAACATGCACATAG. Deletion right flank: GTTTTTTGAAACACTGAAAAAATAAAAACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1720 | C. elegans | rpn-1(ok2259) IV/nT1 [qIs51] (IV;V). Show Description
T22D1.9. Apparent homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2259 homozygotes (arrest stage/phenotype undetermined). Viable WT non-GFP segregants are not homozygotes but rare recombinants. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTTGACCAACACGAACAGA. External right primer: TGACTGCGCCTTTAAACAAA. Internal left primer: TCAAGCTTCCAGGCTTCATT. Internal right primer: TGGTGGCGACTACTCAACAG. Internal WT amplicon: 2938 bp. Deletion size: 1651 bp. Deletion left flank: TATGAACAAGGGAATAGCCAAAACTCGAGG. Deletion right flank: ATGGCTTGTAAAGTGTTCAATTTCAGGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1730 | C. elegans | C36B1.8(ok2141) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C36B1.8. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2141 homozygotes (often sterile or nearly sterile, but a population can be maintained and will starve a plate). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAAGGACGGCTGTTCCTAAA. External right primer: CATATTGAGCTGGAGTCGCA. Internal left primer: CGAGTACAGAACCGAGGAGG. Internal right primer: ACAATACGCTCTCCGTTTGG. Internal WT amplicon: 3357 bp. Deletion size: 1835 bp. Deletion left flank: TTCTAGCATCTAAATTTTAACAATTAGATT. Deletion right flank: AAATGTATTTTACAACACAATTTCCCTCTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1732 | C. elegans | let-526(gk816) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C01G8.9. Apparent homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk816 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. (Note: in this strain hT2[qIs48] occasionally recombines such that the GFP and its associated lethality are lost and the non-GFP hT2 left behind still carries the bli-4 mutation of the original hT2. Such a recombination event results in a viable non-GFP animal that is no longer gk816/hT2[qIs48] but is gk816/hT2.) External left primer: GCCATCACTTTCATCGGATT. External right primer: AATAGACGGCACGTGGAAAC. Internal left primer: ATTCGTTGTTGATAAGCCGC. Internal right primer: ATGACCGATGATGATGACGA. Internal WT amplicon: 1843 bp. Deletion size: 1268 bp. Deletion left flank: AGACATAGACGTCATGCGAAAAATAATATA. Deletion right flank: TCTATATATTCTCCGCGTGGTGGGCTATTT. Insertion Sequence: TATAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1733 | C. elegans | nekl-2(gk839) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ZC581.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk839 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGCGCCCTCTAAATTGTCA. External right primer: GCAGATTTCGTTCCAAGCTC. Internal left primer: TCTTTGTTAGCCATTTCCGC. Internal right primer: GAACAGTCTTTCGGCGATTC. Internal WT amplicon: 1654 bp. Deletion size: 506 bp. Deletion left flank: ATTTCTTGCCGTTTCGTTGAAATTGTTAAC. Deletion right flank: TGTGTTATAATCTACTAACTTTATAATTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1739 | C. elegans | szy-4(ok2324)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C30B5.1, C30B5.2. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2324 homozygotes (sterile, no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AGGGGTACGGTCGAAAGTCT. External right primer: CCGACTGATCCTTATTCCGA. Internal left primer: AACACAGCGACGTCAGAATG. Internal right primer: GCAAGCATCATCGTCTTCAA. Internal WT amplicon: 2125 bp. Deletion size: 1066 bp. Deletion left flank: TCCAATTCAGATAGCAAACAGTGCATGCTT. Deletion right flank: GGTATCTTTAGTTTTATTTAAAATTTATGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1741 | C. elegans | spe-11(ok2143) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F48C1.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2143 homozygotes (sterile, lays unfertilized oocytes). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTGGGTGCAAAACAGGTTC. External right primer: GGCTTACAGCTCTTGGTGGA. Internal left primer: GACCAAATTGAAGCGCATTT. Internal right primer: GAACATTTTTCCGTCAACCG. Internal WT amplicon: 2133 bp. Deletion size: 1196 bp. Deletion left flank: TCTCCAAACTCACTTATTGGAAAAAGCGTC. Deletion right flank: ATAAGTGAGATATCGGCCAAGCAATAGGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1752 | C. elegans | Y23H5A.2&cars-1(ok2280) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y23H5A.2, Y23H5A.7. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2280 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTCCATGGAAAAGATCCGAA. External right primer: TGGAACGGAGGTAAAACGAC. Internal left primer: ACCCCATATCGTGTCAATGG. Internal right primer: ACGGATTCAAGATCTGGTGG. Internal WT amplicon: 2132 bp. Deletion size: 475 bp. Deletion left flank: CAACGCGACCGCCGAAGCCGCACAATTCTG. Deletion right flank: TTCTCCGGATCTCGAAGAAAAACGCCGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1764 | C. elegans | F12F6.7(ok2252) IV/nT1 [qIs51] (IV;V). Show Description
F12F6.7. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2252 homozygotes (sterile Unc). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTTTGCCACTTCAGGGAAAG. External right primer: AGACAAGGCTGGTCCTGCTA. Internal left primer: GGCAAACAACAAGGCAATTT. Internal right primer: GATCACGCCAAAGCAAATCT. Internal WT amplicon: 3379 bp. Deletion size: 1510 bp. Deletion left flank: TAGGGTGTTCGTTTTTCGATTTTTTTTTTA. Deletion right flank: ATTTCATTCAGAAGTCCGGGATTAAGTGGA. Insertion Sequence: TTATGCCATTTGAAAGAGCATTTTTTAAATGTTTTTCGATTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1765 | C. elegans | rpl-20(ok2256) IV/nT1 [qIs51] (IV;V). Show Description
E04A4.8. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2256 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTCCGTAATTTGTTCGCGTT. External right primer: GATTGCTGATAACCCGTCGT. Internal left primer: GTTCCGATTTCTTGGTGCAT. Internal right primer: GAAACATGTGCAAGAGCCATT. Internal WT amplicon: 2463 bp. Deletion size: 1213 bp. Deletion left flank: TAAGAATTAATTTACCTTATCGAAATAGTG. Deletion right flank: TTCTATTACCGTATCCTTCATACACTCGCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1770 | C. elegans | Y73B6BL.1(ok2308) IV/nT1 [qIs51] (IV;V). Show Description
Y73B6BL.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2308 homozygotes (mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTCCGAGAAGAGTACGCAGC. External right primer: GCATAAAAATTCCTGCCTGC. Internal left primer: CGGAATCCGAAAATGCATAC. Internal right primer: AGCTTTCCCCCGATTGTACT. Internal WT amplicon: 3151 bp. Deletion size: 1058 bp. Deletion left flank: GAAAATAAATTGAAAAATAATTTTTCAGGG. Deletion right flank: TAACAAGTTATAGCCGCAATGAATTTTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1771 | C. elegans | apc-1(gk824)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
W10C6.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk824 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TATGTGGAACCGAAGGAAGG. External right primer: CAGGCGTTGTTCTTTCACAA. Internal left primer: GGTCTCAGTCACCGGAGAAG. Internal right primer: ATTCAATGACCAACACGGCT. Internal WT amplicon: 2186 bp. Deletion size: 1963 bp. Deletion left flank: TGGAAGAATGCGGAGACTACACGAAAAAAT. Deletion right flank: AAAGTTATGAATTATCGTGCATTCGAGGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807. Formerly known as mat-2.
|
|
| VC1772 | C. elegans | skn-1(ok2315) IV/nT1 [qIs51] (IV;V). Show Description
T19E7.2. Homozygous viable/sickly deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2315 homozygotes (viable, sickly, some eggs don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGAAACCGACGTAATGTGGA. External right primer: TTTCACCTCCCACCGTCTAC. Internal left primer: CTCAACTGGGCATCTTCACA. Internal right primer: TTTCAGCCATCTCTCCTCGT. Internal WT amplicon: 2440 bp. Deletion size: 1103 bp. Deletion left flank: TTTTTGTATGTAAATTGCCAATGCCATAAT. Deletion right flank: CTCATAGGGTCGAGAGAAAATGAGAGAGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1774 | C. elegans | nekl-2(gk841) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ZC581.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk841 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGCGCCCTCTAAATTGTCA. External right primer: GCAGATTTCGTTCCAAGCTC. Internal left primer: TCTTTGTTAGCCATTTCCGC. Internal right primer: GAACAGTCTTTCGGCGATTC. Internal WT amplicon: 1654 bp. Deletion size: 354 bp. Deletion left flank: TTCAAATGGACAATTATGAAAAAGTGCGTG. Deletion right flank: TATTGATTCTTTTATTATGGATAATCAACT. Insertion Sequence: ATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1780 | C. elegans | vps-28(ok2278)/hIn1 [unc-101(sy241)] I. Show Description
Y87G2A.10. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2278 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAAGACGTTGTGTCTTCCCG. External right primer: CTACAAACCGAGCTGAGCCT. Internal left primer: CCTCACAATTTTGAAACTGCTC. Internal right primer: AATTTCGAGTTTTCGCTTGAA. Internal WT amplicon: 3080 bp. Deletion size: approximately 1600 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1783 | C. elegans | F49E12.6(gk835)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F49E12.6. Apparent homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk835 homozygotes (arrest stage/phenotype undetermined). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGCTCTGGGAACTCTTCGAT. External right primer: GGAGTGGTCGGTGTTGAAGT. Internal left primer: TATTTGGTGACGTGGCATTG. Internal right primer: CCACGTGGTGATGACAACTC. Internal WT amplicon: 2404 bp. Deletion size: 812 bp. Deletion left flank: GGCATAGTTATGGTTTTTCTTATTCTATGT. Deletion right flank: TTTGGGATTGCTCTGTCAAAGATTTCTGAT. Insertion Sequence: TTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1787 | C. elegans | C17E4.6(ok2296) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C17E4.6. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2296 homozygotes (viable Unc, sickly, BMD, vulval defects). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CACGACCTCTTGGACGAAAT. External right primer: CCAACCCCAACTGCCTACTA. Internal left primer: AGTGCGAGTGCGTTACACTG. Internal right primer: GGAGCCATAGTCGAGAGACG. Internal WT amplicon: 2597 bp. Deletion size: 1233 bp. Deletion left flank: GATGATATTCTAGCTAAGAACAAGAAATGG. Deletion right flank: TCAACGACGACAACTCTACCAGTCAACGTC. Insertion Sequence: C. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1788 | C. elegans | ast-1(ok2359)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
T08H4.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2359 homozygotes (embryonic or early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATAGGCCACCAGCTTCTCAA. External right primer: CCCAACTACCAACACAGGCT. Internal left primer: GACAATAGCGAAGAGCCGTC. Internal right primer: TGTGATCAAGTATTCGGCCA. Internal WT amplicon: 2386 bp. Deletion size: 946 bp. Deletion left flank: CACAGATAATAGAGCTTTTTGGAGCAGCAC. Deletion right flank: TTCATCGTCGTCGCCGAATCATCGGCGGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1790 | C. elegans | ech-4(ok2291)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
R06F6.9. Apparent homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2291 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CGGTGAGTTTCGTTGGAAAT. External right primer: AAATGCTGCTCAAAAGCGAT. Internal left primer: ATTTCAGGCGTTCAGGATTG. Internal right primer: AACTTTTGTTGCCCGATTTG. Internal WT amplicon: 2356 bp. Deletion size: 1254 bp. Deletion left flank: GCGCAGAAAAATCTGAAAACTCTGAAGGAA. Deletion right flank: AATATCAACTGCTTTGCTCATCAAGAACTA. Insertion Sequence: AA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1794 | C. elegans | mop-25.2(ok2073)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Y53C12A.4. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2073 homozygotes (sterile with very occasional progeny). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGATCTGAGCAAGTCGATGG. External right primer: TCTCCTCTGCGATTTTCCTC. Internal left primer: CGGAAAGGGGATGGATATTT. Internal right primer: ACCGGTTTCCCAAATTTTTC. Internal WT amplicon: 2262 bp. Deletion size: 1677 bp. Deletion left flank: TCACAAATGATAATTGTGGTTTTTTTTTGA. Deletion right flank: TTCGATAGCTTTTTCGACTTTCCGCTCACT. Insertion Sequence: TAGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1796 | C. elegans | ZK1127.5&ZK1127.12(ok2279)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
ZK1127.5, ZK1127.12. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2279 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AATATGTTGCAAAGGACCGC. External right primer: CTCAGCACCTTCCAATCCTC. Internal left primer: TGAATTCTCACAATGGAGCG. Internal right primer: AAATCTGAGCCGGTCCTGTA. Internal WT amplicon: 3074 bp. Deletion size: 1999 bp. Deletion left flank: TTTAGTTTCTATTTGAGCTCAATCCTCAAA. Deletion right flank: ATCTACGGTAACAGTGTCCGATCTACGGTA. Insertion Sequence: GGAAGTGTGAAACATCTTTAGGACAGAGTGTCATAAATGTGCTTGCAAGTATTTGAGCA CTACTGTCAAGGGCACCTCCCATGTAAATTTGTTGAAGAAGAGCATGACCGGCTTCAAT TCCAATGTCTTCTGGAAGAATTGGAACTCCTGATTCGCCCTTCGGTCTTGAAATAGCTT CTGCTTGGTAGATAACACCCTCTGTCGTTTCGGCGGTTAAGAACAGACCATATCCTGGA GAAGCGCCACCAGCATCACCTTTCCGTTGATCAACAGTAATATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1810 | C. elegans | pyr-1(ok2391)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
D2085.1. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2391 homozygotes (sterile, eggs don't hatch). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAAGCAGCTGAAGAGTTGGG. External right primer: CTCTATTCGCCATCTGAGCC. Internal left primer: AGTTCTTGTCAGAGCCGCAT. Internal right primer: ATTAGCAGGGAAGGCACTCA. Internal WT amplicon: 3370 bp. Deletion size: 2034 bp. Deletion left flank: GGTGTCCGATCATGCTGACGGTTTCTCTCC. Deletion right flank: ATGGCAATTGACAATGGAATTCCCTTGATA. Insertion Sequence: GA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1825 | C. elegans | F44E2.8&F44E2.9(ok2134) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F44E2.8, F44E2.9. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2134 homozygotes (sterile, lays no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAGCTGGTTGGTTTCACCAT. External right primer: ATATGTGGAACTTGCCGGAG. Internal left primer: CATTGGAGAGAGCTTAGGCG. Internal right primer: TCGTTTTTAAATTTCCGCCA. Internal WT amplicon: 2111 bp. Deletion size: 1195 bp. Deletion left flank: TTTTTGTCGAACTTCATTCTTTACTTTACT. Deletion right flank: GGAAATAAAATCGATAAAAACTTTAAAATT. Insertion Sequence: CACGACTTCCTGTTTCTTCAGAAAAACTCTGAATGGCCGTTTCCCATTTTGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1828 | C. elegans | tag-164&abcf-2(ok2388) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y76A2A.1, T27E9.7. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2388 homozygotes (small, sickly, tends to die out but populations are possible to maintain). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGAAGCAGTTGATAGCCTCG. External right primer: CGTCGCTTTTTCCGTGTATT. Internal left primer: ATAGCTGTTTCATCGGGCAC. Internal right primer: AATTTAGGGTACCCCATCCG. Internal WT amplicon: 3031 bp. Deletion size: 1245 bp. Deletion left flank: CAGGCTAAATTAGCATATTTACACAGACGA. Deletion right flank: CCGCTTGAAGAGCAGTTTTCTCTGAAGCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1830 | C. elegans | rho-1(ok2418) IV/nT1 [qIs51] (IV;V). Show Description
Y51H4A.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2418 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGGGAGAGGAGATGTGTGAT. External right primer: GCAAATCCAGGTTTTTCCCT. Internal left primer: ATTGGAATAGAGAAGCGCGA. Internal right primer: TTTTCACCCGAAAATCCAGA. Internal WT amplicon: 3317 bp. Deletion size: 2091 bp. Deletion left flank: ATTTGGGGGAAAATTAGATGAACTTTTGTT. Deletion right flank: AAAAAACTTAAATTTTCAGCAAAAATTGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1831 | C. elegans | vha-16(ok2332) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C30F8.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2332 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCAGATCCAGGAAGGAATGA. External right primer: CGAAAATAATTGCAGCCCAT. Internal left primer: TTGCGAAGCCGATTTAGTTT. Internal right primer: TTCTTTCGCCTCCTTTTTCA. Internal WT amplicon: 2112 bp. Deletion size: 831 bp. Deletion left flank: TTTCGAAAAACCAGGCCGTAAACTGACAGC. Deletion right flank: TTTTTTTTCAAATTAAATTATTATACAACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1832 | C. elegans | ifb-2(ok2420)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F10C1.7. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2420 homozygotes (probable embryonic arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ACTCTGCTCCTGCTTTGCAT. External right primer: CCGAGTTATCGTGACCCACT. Internal left primer: AGCAGTGGGAGTGCAAGACT. Internal right primer: ACGTCGAATGATTTTGGGAG. Internal WT amplicon: 3175 bp. Deletion size: 2459 bp. Deletion left flank: TGAGGATCGTAACAAGGAGCTTGTGATTGA. Deletion right flank: ACCACCAGACTCAATTGTGATGGAATCTCA. Insertion Sequence: TATTGAAAACTTTTCAGGGTGATATTCCCAGTCTTCTTCAACAAGCTTCACCTCCAGGA GGAGTTAAATCTCCATCAGCTGTAGTATTTCCGCCTGTTTCCGCAGCTGTCGCTGCAAT CACTGAAATTTCTCCACAAAGTAGCTACTCATCAATTGTGCCAAAAGTGGAAACCGATC AAATCTCCCAACAACTATTTAAATGTTAGTTTTTTATGCGATACAATTATTGCATCAAA CTAATTTTCTCATGTTTCCAGCTCTTCCTTTGTGGTCATTCCAACAAACTCCTGGATTA CCTATCGGAATGGATCTATCACAACTTGTTTTCCAACAATCCTCTCCCGACAAAACAGT TTCACCTGTGAAATCAGAAGTTGTAGAAGAAACGAAACCAATCGCTTCTTCACAATTAA CACTTCACAGCTTCTCCGCATATGTCAAATGTAATAAGACAAGTTTAAGGACAGAACTC GTGAAGATTGAGAATACACTGGAAAAAGATGATATTGACATTTCTGTATTTTACGAAAA ATATCCGAAATTACTTCGAGAATTGTTCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1833 | C. elegans | sem-2(ok2422) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C32E12.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2422 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AACGAATGAAAACTGGCTCG. External right primer: ATATGATGCCGCCGATTAAC. Internal left primer: CAATCGCTTGGATTTGTTGA. Internal right primer: CAATTGCAGTAGCCTCATCG. Internal WT amplicon: 3044 bp. Deletion size: 2389 bp. Deletion left flank: AAGTTGGTGCTGGTGATGGTGCGAAGTGGT. Deletion right flank: CCAGAAGTCGATGAGGCTACTGCAATTGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1834 | C. elegans | C25H3.8(ok2438)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C25H3.8. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2438 homozygotes (sterile, lays no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCCATCAGCTTCAACAACGA. External right primer: TGAAGCTTGGATGGTGTTCA. Internal left primer: CTTCCATCAGGCATCCAAGT. Internal right primer: CAAAGATGCTCGTGCTTTGA. Internal WT amplicon: 2972 bp. Deletion size: 1859 bp. Deletion left flank: CAAATTTTCAATTCTGATTGGTGGTGGATA. Deletion right flank: GAAGTTTGGTATTCCATTGAATCGATTGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
- Job Opportunities within the CGC
- CGC Home
- Search Strains
- Register
(existing labs) - Request a Lab Code
(new labs) - Strain List
- Strain Donation
(Users must be signed in) - Request Knockout
(of Alzheimer's related genes) - Lab List
- Acknowledging the CGC
- Contact
- Frequently Asked Questions (FAQs)
- Conditions Of Use