Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
PS7058 C. elegans syTi2 II. Show Description
syTi2 [mos 5'-hsp-16.2 5'::fars-1(A, N, M1-G203)::gp41-1(N, C1-E88)::fib-1/rps-16::GFP::unc-54 3'-myo-2 5'::gp41-1(C, M1-S38)::fars-1(A, C, S204-K552, T468G)::rpl-16/M01F1.8::mCherry::let-858 3'-rpl-27 5'::neoR::unc-54 3'-mos 3']. Mapped by Inverse PCR to Chromosome II: (344975-344974).
PX623 C. elegans fxDf1 II; him-5(e1490) V. Show Description
fxDf1 (II: 2,484,339 - 2,487,244) removes nspf-1, nspf-2, and nspf-3. Him. This strain carries a knockout of the Nematode-Specific Peptide family, group F (NSPF) gene family, which localizes to sperm membranous organelles. There are no effects on spermatogenesis, male fertility, or sperm competitive ability. Hermaphrodites produce approximately 30% males. Reference: Kasimatis KR, et al. (2018) BioRxiv 290221; doi: https://doi.org/10.1101/290221.
RAF1 C. elegans unc-119(ed3) III; rrrIs1. Show Description
rrrIs1 [pie-1p::GFP::Histone H2B::cye-1 3'UTR + unc-119(+)]. Slightly Unc.
RB1273 C. elegans T05F1.4(ok1364) I. Show Description
T05F1.4 Homozygous. Outer Left Sequence: tgctgatgtagtcgacggag. Outer Right Sequence: acaataacccagacgcgaac. Inner Left Sequence: attcttggcaaagctcctga. Inner Right Sequence: gcaaaacttcgtgtttgggt. Inner Primer PCR Length: 2312. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1345 C. elegans coq-4(ok1490) I. Show Description
T03F1.2. Homozygous. Outer Left Sequence: ATGAAGTTGTCAAGGCCACC. Outer Right Sequence: CGTTTCAATGAGCCTGGAGT. Inner Left Sequence: ATTGGAGGAGGTGACACTGC. Inner Right Sequence: AGAGTTGAAGAGAATGCGGC. Inner Primer PCR Length: 2182 bp. Deletion Size: 1210 bp. Deletion left flank: AACACACGACTTCACCCACATCGCATTGGA. Deletion right flank: TTTAGCACGTGTCTCAGCTTCTGCCGCATT. Insertion Sequence: CG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1370 C. elegans F01F1.4(ok1555) III. Show Description
F01F1.4 Homozygous. Outer Left Sequence: ctactgggcgaaagttcgag. Outer Right Sequence: caacgacgaaactgtgatcg. Inner Left Sequence: tttgggtcctggaaagaaaa. Inner Right Sequence: ttctagcacacggatgatgc. Inner Primer PCR Length: 2295. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1371 C. elegans hil-3(ok1556) X. Show Description
F22F1.1 Homozygous. Outer Left Sequence: ccaagaaacgatcggactgt. Outer Right Sequence: attgtgtgttgcgttggaaa. Inner Left Sequence: cacgttggagaaacagacga. Inner Right Sequence: ttgggagggtgagaagacac. Inner Primer PCR Length: 2159. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1480 C. elegans T05F1.1(ok1731) I. Show Description
T05F1.1 Homozygous. Outer Left Sequence: cttcaagagtggccatttcc. Outer Right Sequence: cttcaagagtggccatttcc. Inner Left Sequence: tttaatgcgggaaagtgacc. Inner Right Sequence: catgcgtgtgcctttaactg. Inner Primer PCR Length: 2592. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1497 C. elegans F44F1.1(ok1765) I. Show Description
F44F1.1 Homozygous. Outer Left Sequence: gttgagtcttttaccccgca. Outer Right Sequence: cattgattgcacggatgaag. Inner Left Sequence: caaaattgtctactgcgcca. Inner Right Sequence: cttcgcgacaatcctaggtc. Inner Primer PCR Length: 3063. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1746 C. elegans C15F1.5(ok2231) II. Show Description
C15F1.5. Homozygous. Outer Left Sequence: CACTCCGACAACAGGCAGTA. Outer Right Sequence: AGCACCGCAACTACCTCAAG. Inner Left Sequence: CGGAGTGTCGTTAGCCAGAT. Inner Right Sequence: GCCATCGTTCCATTTGTTCT. Inner Primer PCR Length: 3106 bp. Deletion Size: 1194 bp. Deletion left flank: TGTGTAATTAAATGAGCCGAAAAACTATAC. Deletion right flank: AACCAAGACTTGCAACATTTTTCAAGCAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1949 C. elegans tra-2(ok2563) II. Show Description
C15F1.3 Homozygous. Outer Left Sequence: aaccagaaaagtcgccttga. Outer Right Sequence: tccacatcaagcatccagaa. Inner Left Sequence: ttggtgtgatggcaaagatg. Inner Right Sequence: atgcattcctgcgattcttc. Inner Primer PCR Length: 3370. Deletion size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1983 C. elegans K05F1.5(ok2617) II. Show Description
K05F1.5. Homozygous. Outer Left Sequence: CTCACATTCACCCAGTGTGC. Outer Right Sequence: AACATCCCAACCACGAACTC. Inner Left Sequence: TTGGTGAGTACACCCTGAACA. Inner Right Sequence: TATTGCAAGTTGTTTTGCGG. Inner Primer PCR Length: 3142 bp. Deletion Size: 1240 bp. Deletion left flank: CCATTTGTCGTCAGGAACATTGGCTAGAAA. Deletion right flank: TGCACATATCTTCTGTTAAATTGTCCTTTT. Insertion Sequence: CATATTTTTTGTTAAAT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2246 C. elegans T11F1.9(ok3040) II. Show Description
T11F1.9. Homozygous. Outer Left Sequence: ATTCCCGCTGTGATGAAAAG. Outer Right Sequence: CCGCAGATTTCAACAAGGAT. Inner Left Sequence: GAAGATGATGTACTCACTCCCAA. Inner Right Sequence: TGAAAGAACTCAAAGCGCAA. Inner Primer PCR Length: 1360 bp. Deletion Size: 675 bp. Deletion left flank: TATGAAATGATAAGGAGACTTACGGCAATC. Deletion right flank: TTCCAAGTTTTCCCCAAAATGATTCGAATG. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2322 C. elegans K05F1.6(ok3154) II. Show Description
K05F1.6 Homozygous. Outer Left Sequence: atcaatgctcggagtgttcc. Outer Right Sequence: tccggtagtggcttctcact. Inner Left Sequence: tgtgcatggaaatcacaggt. Inner Right Sequence: ttctggtaatacgaacaccaaca. Inner Primer PCR Length: 1188. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2441 C. elegans uba-5(ok3364) I. Show Description
T03F1.1 Homozygous. Outer Left Sequence: tttaaaccgccttggaaatg. Outer Right Sequence: agtgtgatggaaggcgagag. Inner Left Sequence: gaaagaccaccctctggagtc. Inner Right Sequence: gctccgactcatttaccagc. Inner Primer PCR Length: 1112. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB916 C. elegans gly-14(ok787). Show Description
M01F1.1. Homozygous. Outer Left Sequence: GGAATTGACACCCTTGCTGT. Outer Right Sequence: AAAGCAGTGGAAATCGGAAA. Inner Left Sequence: AGTGTAGGGACATGCTTGGG. Inner Right Sequence: ATGCGCCTTTAAAAATCGAG. Inner Primer WT PCR product: 3312. Deletion size: 693 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB982 C. elegans flp-21(ok889) V. Show Description
C26F1.10. Homozygous. Outer Left Sequence: TCTGATGCGTTTACAGTCGG. Outer Right Sequence: TTTTCTTGTTCAACGGCCTC. Inner Left Sequence: TTAAGCGGAGCACACTTCCT. Inner Right Sequence: GGCAATTGAAAATTGTTGCC. Inner Primer WT PCR product: 3182. Deletion size: 1786 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG3109 C. elegans F23F1.5(ve609[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sqt-2(sc3) II. Show Description
Homozygous sterile. Deletion of 1538 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygous adults are Rol GFP+, and segregate Rol GFP+ adults, non-Rol GFP+ sterile adults (ve609 homozygotes) and non-Rol non-GFP adults (sc3 homozygotes). Maintain by picking Rol GFP+ adults.
RG3123 C. elegans veDf1 [LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP] IV. Show Description
Homozygous viable. Deficiency of 4040 bp, removes his-55, his-56, his-58 and his-57, with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaacgtggtactgtaatcgttgcgagacct ; Right flanking sequence: actgtttaattttaaaagcgtctataacgt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3156 C. elegans +/nT1 [umnIs49] IV; F53F1.2(ve656[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Mel. Deletion of 1448 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate adults that lay dead eggs (ve656 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).
RP2682 C. elegans mev-1(tr395) III. Show Description
Homozygous viable. mev-1(tr395) is a G398A (G133E) missense mutation. mev-1 also known as sdhc-1. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
RP2687 C. elegans mev-1(tr399) III. Show Description
Homozygous viable. mev-1(tr399) is a C197T (T66I) missense mutation. mev-1 also known as sdhc-1. Isolated in an F1 screen for resistance to the lethality induced by wact-12. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
RP2688 C. elegans sdhd-1(tr400) II. Show Description
Homozygous viable. sdhd-1(tr400) is a G283A (D95N) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-12. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
RP2696 C. elegans sdhb-1(tr405) II. Show Description
Homozygous viable. sdhb-1(tr405) is a C632T (P211L) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
RP2697 C. elegans sdhb-1(tr406) II. Show Description
Homozygous viable. sdhb-1(tr406) is a C632T (P211L) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
RP2698 C. elegans mev-1(tr407) III. Show Description
Homozygous viable. mev-1(tr407) is a G221A (R74K) missense mutation. mev-1 also known as sdhc-1. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
RP2699 C. elegans mev-1(tr408) III. Show Description
Homozygous viable. mev-1(tr408) is a G230A (G77D) missense mutation. mev-1 also known as sdhc-1. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
RP2700 C. elegans sdhd-1(tr409) II. Show Description
Homozygous viable. sdhd-1(tr409) is a T252A (H84Q) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
RP2702 C. elegans mev-1(tr410) III. Show Description
Homozygous viable. mev-1(tr410) is a T407C (F136S) missense mutation. mev-1 also known as sdhc-1. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
RP2703 C. elegans sdhb-1(tr411) II. Show Description
Homozygous viable. sdhb-1(tr411) is a T779A (I260N) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
RP2706 C. elegans sdhb-1(tr414) II. Show Description
Homozygous viable. sdhb-1(tr414) is a C632T (P211L) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-11. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
RP2748 C. elegans mev-1(tr423) III. Show Description
Homozygous viable. mev-1(tr423) is a G233A (C78Y) missense mutation. mev-1 also known as sdhc-1. Isolated in an F1 screen for resistance to the lethality induced by wact-127. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
RP2768 C. elegans sdhd-1(tr436) II. Show Description
Homozygous viable. sdhd-1(tr436) is a G283A (D95N) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-127. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
RP2776 C. elegans sdhb-1(tr438) II. Show Description
Homozygous viable. sdhb-1(tr438) is a C436T (H146Y) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-127. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
RP2813 C. elegans sdhb-1(tr454) II. Show Description
Homozygous viable. sdhb-1(tr454) is a C434T (P145L) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-127. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
RP2814 C. elegans sdhb-1(tr455) II. Show Description
Homozygous viable. sdhb-1(tr455) is a C436T (H146Y) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-127. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
RP2815 C. elegans sdhd-1(tr456) II. Show Description
Homozygous viable. sdhd-1(tr456) is a G289A (A97T) missense mutation. Isolated in an F1 screen for resistance to the lethality induced by wact-127. Reference: Burns AR, et al. Nat Commun. 2015 Jun 25:6:7485. doi: 10.1038/ncomms8485. PMID: 26108372.
RW11781 C. elegans unc-119(tm4063) III; stIs11781. Show Description
stIs11781 [F23F1.1::H1-wCherry + unc-119(+)].
RW11980 C. elegans unc-119(tm4063) III; stIs11980. Show Description
stIs11980 [K05F1.5::H1-wCherry + unc-119(+)].
SF1 C. elegans odc-1(pc13::Tc1) V. Show Description
Made by PCR screen of Tc1 transposon insertion library. odc-1(pc13::Tc1) has a partial deletion of the Tc1 element. Phenotypically it has 35% reduction in brood size compared to the WT N2 Bristol strain.
SOL19 C. elegans ceh-38(tm321) II; ceh-44(ot1028) III; ceh-48(tm6112) IV; otIs669 him-5(e1490) V; otDf1 X. Show Description
NeuroPAL landmark reporter in a sextuple CUT mutant background. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). otDf1 is a deletion affecting ceh-41, ceh-21, T26C11.9, and ceh-39. Reporter expression is affected in this mutant, suggesting alterations in neuronal identity.
SP262 C. elegans mnDp1(X;V)/+ V; mnDf1 X. Show Description
WT Phenotype. Gives dead eggs.
SP957 C. elegans dpy-8(e130) stDf1 X; mnDp30 (X;f). Show Description
Animals with mnDp30 are WT (slightly Dpy) and segregate WT (slightly Dpy) and dead eggs.
SV273 C. elegans cdk-4(he109) maIs103/+ X. Show Description
maIs103[rnr::GFP unc-36(+)]. Heterozygotes produce 1/4 thin, sterile, uncoordinated animals that fail to undergo postembryonic somatic cell divisions. rnr::GFP is expressed during S-phase in heterozygous animals. rnr::GFP expression is not detected in heDf1 animals. Although the map position of maIs103 has not been determined conclusively, maIs103 genetically behaves linked to cdk-4. Maintain by picking several single animals and scoring for 1/4 mutant progeny.
SV275 C. elegans cdk-4(he111) maIs103/+ X. Show Description
maIs103[rnr::GFP unc-36(+)] X. Heterozygotes produce 1/4 thin, sterile, uncoordinated animals that fail to undergo postembryonic somatic cell divisions. rnr::GFP is expressed during S-phase in heterozygous animals. rnr::GFP expression is not detected in heDf1 animals. Although the map position of maIs103 has not been determined conclusively, maIs103 genetically behaves linked to cdk-4. Maintain by picking several single animals and scoring for 1/4 mutant progeny.
SV411 C. elegans heDf1 maIs103/lon-2(e678) unc-9(e101) X. Show Description
maIs103[rnr::GFP unc-36(+)] X. The heDf1 deletion includes cdk-4. Heterozygotes produce 1/4 thin, sterile, uncoordinated animals that fail to undergo postembryonic somatic cell divisions. heDf1 mutants are of L1 size, smaller than cdk-4 mutants. lon-2 and unc-9 do not exactly balance heDf1, but unc-9 is pretty close. It should also be possible to follow the heterozygotes by looking at the GFP. Despite trying, unable to separate the maIs integration from heDf1 or the other cdk-4 alleles. By maintaining animals with GFP (visible especially in early animals and in eggs) you should be able to maintain heDf1. rnr::GFP is expressed during S-phase in heterozygous animals. rnr::GFP expression is not detected in heDf1 animals. maIs103 is tightly linked to heDf1. Maintain by picking several single animals and scoring for 1/4 mutant progeny.
TU899 C. elegans stDp2(X;II)/+ II; uDf1 X. Show Description
Strain throws WT and dead eggs.
TU900 C. elegans +/szT1 [lon-2(e678)] I; uDf1/szT1 X. Show Description
Heterozygotes are WT and segregate WT, Lon males and dead eggs. Maintain by picking WT. [4/98: Lon males are sickly and Unc. uDf1 appears to still be present.]
TY404 C. elegans +/szT1 [lon-2(e678)] I; lin-15B&lin-15A(n765) yDf1/szT1 X. Show Description
Heterozygotes are WT and segregate WT, dead eggs, and Lon males. Maintain by picking WT.
UL768 C. elegans pes-1(leDf1) IV. Show Description
No obvious altered phenotype. Deletion removes 1.9 kb from within pes-1, including more than half of the forkhead domain encoding region.