| CB3824 |
C. elegans |
eDf19/unc-24(e138) dpy-20(e1282) IV. Show Description
Heterozygotes are WT (somewhat Unc and Egl) and segregate WT, DpyUnc and dead eggs. Maintain by picking WT.
|
|
| CB4504 |
C. elegans |
gon-1(e1254)/eDf18 IV. Show Description
Heterozygotes mostly fertile at or below 20C; all sterile at 25C. Progeny are fertile heterozygotes with variable Gon abnormality, e1254 homozygotes (strong Gon, "white patch" phenotype) and eDf18 homozygotes (embryonic lethal). See also WBPaper00003841.
|
|
| CB4681 |
C. elegans |
nDf17/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are Dpy and segregate Dpy, Sterile Dpys and dead eggs. [CGC received new stock in 1/1999 from Leon Avery.]
|
|
| CB5101 |
C. elegans |
dpy-26(n199) IV; eEx36. Show Description
eEx36 [F16E1 + rol-6(su1006)]. eEx36 carries multiple copies of fox-1, which confers a Xol phenotype and pRF4 which confers a Rol phenotype. dpy-26(n199) is XO viable and XX lethal. Strain consists mostly of Rol hermaphrodites and non-Rol males, all XO.
|
|
| CB5348 |
C. elegans |
mrt-2(e2663) III. Show Description
Unable to propagate indefinitely: lines become sterile from F10-F28, with short telomeres and fused chromosomes. Hypersensitive to X-irradiation; weak Him phenotype; strong Him phenotype in later generations resulting from X-A fusions. Cross once or twice, freeze down many F2 mrt-2 plates, and go back to these plates every two months for fresh a mrt-2 line. A BstN1 RFLP makes the mrt-2 mutation easy to track.
|
|
| CER529 |
C. elegans |
sftb-1(cer144) III. Show Description
Dose-dependent sensitivity (developmental arrest) to pladienolide B and herboxidiene (modulators of pre-mRNA splicing). sftb-1(cer144[S1090A, A1095T, I1096V, F1101Y]) contains four missense mutations reproducing the HEAT repeat 15 of the human SF3B1 protein. Ten silent mutations increase primer specificity for PCR genotyping. Primers used for genotyping: (WT For: GAGCTGCAATTAATACATTTGGATTT) (WT Rev: AAACTCGCATTCCTTCACAT) (cer144 For: GGTACTATTCTGTGGCGTCT) (cer144 Rev: GTAACCGAAAGTGTTCACAGTT) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464.
|
|
| CF1038 |
C. elegans |
daf-16(mu86) I. Show Description
Dauer defective. Short lived.
|
|
| CF1045 |
C. elegans |
muIs49. Show Description
muIs49 [unc-22(+) egl-20::GFP]. Rescuing translational egl-20::GFP fusion. Not known to which LG muIs49 is attached. A few cells in the tail will light up with GFP.
|
|
| CF1097 |
C. elegans |
ref-1(mu220) II. Show Description
P9.p and P10.p fail to fuse with hyp7 during L1 in hermaphrodites. Misshapen head (low penetrance) most visible in L1. Ectopic postdeirid generated by V6 (low penetrance).
|
|
| CF1135 |
C. elegans |
egl-20(n585) IV; muEx68. Show Description
muEx68 [(pJW33) myo-2p::egl-20::GFP + (7PD10.46) unc-22 (antisense)]. Use nicotine or levamisole to pick twitchers. Reference: Whangbo J & Kenyon C, (1999) Mol Cell 4(5):851-8.
|
|
| CF1137 |
C. elegans |
daf-16(mu86) I; daf-2(e1370) III; muIs61. Show Description
muIs61 [daf-16a::GFP + rol-6(su1006)]. Temperature-sensitive. Maintain at 15 C. Rollers. Reference: Lin K, Hsin H, Libina N, Kenyon C. Nat Genet. 2001 Jun;28(2):139-45.
|
|
| CF1139 |
C. elegans |
daf-16(mu86) I; muIs61. Show Description
muIs61 [(pKL78) daf16::GFP + rol-6(su1006)]. muIs61 rescues daf-16(mu86). muIs61 is a gamma-induced insertion of muEx50. muIs61 insertion point has not been mapped.
|
|
| CF1170 |
C. elegans |
egl-20(n585) IV; muEx79. Show Description
muEx79 [(pJW33) myo-2p::egl-20::GFP + (7PD10.46) unc-22 (antisense)]. Use nicotine or levamisole to pick twitchers. Reference: Whangbo J & Kenyon C, (1999) Mol Cell 4(5):851-8.
|
|
| CF1192 |
C. elegans |
egl-27(n170) II; muIs35 V. Show Description
muIs35 [mec-7::GFP + lin-15(+)].
|
|
| CF12 |
C. elegans |
rol-6(e187) II; lin-22(n372) IV; him-5(e1490) V. Show Description
Rollers. lin-22 and him-5 mutations affect neuroblast formation from epidermal precursor cell V5.
|
|
| CF1259 |
C. elegans |
mig-13(mu225) lin-15B&lin-15A(n765) X; muIs62. Show Description
muIs62 [mig-13p::mig-13::GFP + lin-15(+)].
|
|
| CF1295 |
C. elegans |
daf-16(mu86) I; daf-2(e1370) III; muEx108. Show Description
muEx108 [(pKL99-2) daf-16::GFP/daf16bKO + rol-6(su1006)]. Grows okay at 20C. Rollers should form dauers at 25C. Pick Rollers to maintain.
|
|
| CF1308 |
C. elegans |
daf-16(mu86) I; muEx116. Show Description
muEx116 [daf-16a::GFP(T54A S240A T242A S314A) + rol-6(su1006)]. Grows at all temperatures. Carries extrachromosomal array. Pick Rollers to maintain.
|
|
| CF1330 |
C. elegans |
daf-16(mu86) I; muEx128. Show Description
muEx128 [(pKL79) daf-16a::GFP) + rol-6(su1006)]. Grows okay at 20C. Pick Rollers to maintain.
|
|
| CF1371 |
C. elegans |
daf-16(mu86) I; muEx151. Show Description
muEx151 [(pKL106-8) daf-16aAM::GFP/bKO + rol-6(su1006)]. Grows okay at 20C. Pick Rollers to maintain.
|
|
| CF1380 |
C. elegans |
daf-16(mu86) I; daf-2(e1370) III; muEx158. Show Description
muEx158 [daf-16cAM::GFP + sur-5p::GFP] (AM = AKT-site mutant). Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less. muEx158 contains GFP-tagged daf-16 c isoform (described as a1 isoform in Lin, et al. Nat Genet. 2001) with 4 Ser/Thr residues mutated to Ala, which completely rescues dauer formation and partially restores longevity of daf-16; daf-2 double mutants. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.
|
|
| CF1395 |
C. elegans |
ceh-20(mu290) III; muIs164. Show Description
muIs164 [tax-4::GFP].
|
|
| CF1407 |
C. elegans |
daf-16(mu86) I; muIs71 X. Show Description
muIs71 [(pKL99) daf-16ap::GFP::daf-16a(bKO)) + rol-6(su1006)]. Grows okay at 20C. Spontaneous integrant. Rollers.
|
|
| CF1442 |
C. elegans |
daf-16(mu86) I; daf-2(e1370) III; muEx169. Show Description
muEx169 [unc-119p::GFP::daf-16 + rol-6(su1006)]. Pick Rollers to maintain. May grow better at 15C.
|
|
| CF1449 |
C. elegans |
daf-16(mu86) I; daf-2(e1370) III; muEx176. Show Description
muEx176 [daf-16p::GFP::daf-16 + rol-6(su1006)]. Pick rollers to maintain -- Low transmission rate! Maintain at 15C. Forms dauers at 25C. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.
|
|
| CF1514 |
C. elegans |
daf-16(mu86) I; daf-2(e1370) III; muEx211. Show Description
muEx211[pNL213(ges-1p::GFP::daf-16) + rol-6(su1006)]. Grows at 15C (probably also at 20C). Pick Rollers to maintain.
|
|
| CF1515 |
C. elegans |
daf-16(mu86) I; daf-2(e1370) III; muEx212. Show Description
muEx212[pNL212(myo-3p::GFP::daf-16) + rol-6(su1006)]. Grows at 15C (probably also at 20C). Pick Rollers to maintain.
|
|
| CF1553 |
C. elegans |
muIs84. Show Description
muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. Green expression in head, tail and around vulva. Many animals roll weakly or not at all, but still express GFP. Grows at all temperatures.
|
|
| CF1580 |
C. elegans |
daf-2(e1370) III; muIs84. Show Description
muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. Green expression in head, tail and around vulva. Daf-C at 25C. Grows well at 20C.
|
|
| CF1588 |
C. elegans |
daf-16(mu86) I; daf-2(e1370) III; muIs84. Show Description
muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. Dim green expression in head, tail and around vulva. Daf-d. Can grow at 20C.
|
|
| CF1595 |
C. elegans |
daf-16(mu86) I; daf-2(e1370) III; muEx227. Show Description
muEx227 [(pNL213) ges-1p::GFP::daf-16) + rol-6(su1006)]. Pick Rollers to maintain.
|
|
| CF162 |
C. elegans |
mig-2(mu28) X. Show Description
mig-2 null mutation. Animals look grossly WT but Q descendants and other migratory neurons misplaced.
|
|
| CF1632 |
C. elegans |
unc-62(mu232) muIs35 V. Show Description
muIs35 [mec-7::GFP + lin-15(+)]. Egl. GFP+. QR pax migration defect.
|
|
| CF1641 |
C. elegans |
qid-6(mu252) III. Show Description
QL descendants migrate anteriorly. Bli. Unc. Weak Dpy.
|
|
| CF1660 |
C. elegans |
daf-16(mu86) I; daf-2(e1370) III; muIs84; muEx211. Show Description
muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. muEx211 [ges-1p::daf-16::GFP + rol-6(su1006)]. Pick Rollers to maintain. Partial rescue of lifespan phenotype. Some animals show variable daf-16 expression in the intestine. Grows okay at 15C. [NOTE: muEx211 is quite unstable. Be sure to pick Rollers to avoid losing the array.]
|
|
| CF1665 |
C. elegans |
muIs32 II; mig-15(mu327) X. Show Description
muIs32 [mec-7p::GFP + lin-15(+)]. QL descendants migrate anteriorly; defects in HSN migration, male tail formation and PLM axon outgrowth. Egl. Unc. Pvl. Weak Dpy.
|
|
| CF1667 |
C. elegans |
mig-15(mu342) X. Show Description
QL descendants migrate anteriorly; defects in HSN migration, male tail formation and PLM axon outgrowth. Egl. Unc. Pvl. Weak Dpy.
|
|
| CF1700 |
C. elegans |
daf-16(mu86) I; mes-1(bn7) X; muEx248. Show Description
muEx248 [(pNL209) daf-16::GFP::daf-16(cDNA) + podr-1::RFP]. Pick green (body) / red (head neurons) animals. Transmission efficiency ~50%. Can be grown at 20C with some sterility (30-50%). The higher the temperture, the greater the sterility.
|
|
| CF1724 |
C. elegans |
daf-16(mu86) I; daf-2(e1370) III; muIs105. Show Description
muIs105 [daf-16p::GFP::daf-16 + rol-6(su1006)]. Rollers; Rol phenotype is not always evident). Integrated line derived from CF1449. Maintain at 15C. Forms dauers at 25C. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.
|
|
| CF1756 |
C. elegans |
ptp-3(mu245) muIs32 II. Show Description
muIs32 [mec-7p::GFP + lin-15(+)]. QL descendants migrate anteriorly.
|
|
| CF1806 |
C. elegans |
ceh-20(mu290) III; muEx261. Show Description
muEx261[ceh-20::GFP at C terminus + odr-1::RFP].
|
|
| CF1814 |
C. elegans |
rrf-3(pk1426) II; daf-2(e1370) III. Show Description
Daf-c at 25.5C; grow at 20C or less. Long lived.
|
|
| CF1824 |
C. elegans |
muEx265. Show Description
muEx265 [hsf-1p::hsf-1(cDNA) + myo-3::GFP]. Pick GFP worms to maintain.
|
|
| CF1827 |
C. elegans |
daf-16(mu86) I; daf-2(e1370) III; muEx268. Show Description
muEx268 [ges-1p::GFP::daf-16(cDNA) + odr-1::RFP]. daf-16 GFP expressed in intestine. Partial rescue of lifespan phenotype. Grows okay at 15C. Pick RFP to maintain.
|
|
| CF1844 |
C. elegans |
rrf-3(b26) II; daf-2(mu150) III; fem-1(hc17) IV. Show Description
Long lifespan. Maintain at 15C. Worms develop slowly at 20C, and are sterile at 25C. Reference: Garigan D, et al. Genetics. 2002 Jul;161(3):1101-12.
|
|
| CF1864 |
C. elegans |
daf-10(mu377) IV. Show Description
Temperature-sensitive allele of daf-10 exhibits dye filling (Dyf) phenotype at 25C and non-Dyf at 20C.
|
|
| CF1874 |
C. elegans |
daf-16(mu86) I; muIs84. Show Description
muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. Green expression in head, tail and around vulva.
|
|
| CF1880 |
C. elegans |
daf-16(mu86) I; glp-1(e2141) III. Show Description
Sterile at 25C; grow at 20C or less. glp-1(e2141) longevity suppressed by daf-16(mu86).
|
|
| CF1903 |
C. elegans |
glp-1(e2144) III. Show Description
Temperature sensitive. Sterile at 25C. Maintain at 15C. [NOTE: CF1903 carries glp-1(e2144), not e2141 as previously described.]
|
|
| CF1935 |
C. elegans |
daf-16(mu86) I; glp-1(e2141) III; muIs109. Show Description
muIs109 [daf-16p::GFP::DAF-16 cDNA + odr-1p::RFP]. Sterile at 25C; grow at 20C or less.
|
|