Search Strains

More Fields
Strain Species Genotype Add
CB3824 C. elegans eDf19/unc-24(e138) dpy-20(e1282) IV. Show Description
Heterozygotes are WT (somewhat Unc and Egl) and segregate WT, DpyUnc and dead eggs. Maintain by picking WT.
CB4504 C. elegans gon-1(e1254)/eDf18 IV. Show Description
Heterozygotes mostly fertile at or below 20C; all sterile at 25C. Progeny are fertile heterozygotes with variable Gon abnormality, e1254 homozygotes (strong Gon, "white patch" phenotype) and eDf18 homozygotes (embryonic lethal). See also WBPaper00003841.
CB4681 C. elegans nDf17/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are Dpy and segregate Dpy, Sterile Dpys and dead eggs. [CGC received new stock in 1/1999 from Leon Avery.]
CB5101 C. elegans dpy-26(n199) IV; eEx36. Show Description
eEx36 [F16E1 + rol-6(su1006)]. eEx36 carries multiple copies of fox-1, which confers a Xol phenotype and pRF4 which confers a Rol phenotype. dpy-26(n199) is XO viable and XX lethal. Strain consists mostly of Rol hermaphrodites and non-Rol males, all XO.
CB5348 C. elegans mrt-2(e2663) III. Show Description
Unable to propagate indefinitely: lines become sterile from F10-F28, with short telomeres and fused chromosomes. Hypersensitive to X-irradiation; weak Him phenotype; strong Him phenotype in later generations resulting from X-A fusions. Cross once or twice, freeze down many F2 mrt-2 plates, and go back to these plates every two months for fresh a mrt-2 line. A BstN1 RFLP makes the mrt-2 mutation easy to track.
CER529 C. elegans sftb-1(cer144) III. Show Description
Dose-dependent sensitivity (developmental arrest) to pladienolide B and herboxidiene (modulators of pre-mRNA splicing). sftb-1(cer144[S1090A, A1095T, I1096V, F1101Y]) contains four missense mutations reproducing the HEAT repeat 15 of the human SF3B1 protein. Ten silent mutations increase primer specificity for PCR genotyping. Primers used for genotyping: (WT For: GAGCTGCAATTAATACATTTGGATTT) (WT Rev: AAACTCGCATTCCTTCACAT) (cer144 For: GGTACTATTCTGTGGCGTCT) (cer144 Rev: GTAACCGAAAGTGTTCACAGTT) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464.
CF1038 C. elegans daf-16(mu86) I. Show Description
Dauer defective. Short lived.
CF1045 C. elegans muIs49. Show Description
muIs49 [unc-22(+) egl-20::GFP]. Rescuing translational egl-20::GFP fusion. Not known to which LG muIs49 is attached. A few cells in the tail will light up with GFP.
CF1097 C. elegans ref-1(mu220) II. Show Description
P9.p and P10.p fail to fuse with hyp7 during L1 in hermaphrodites. Misshapen head (low penetrance) most visible in L1. Ectopic postdeirid generated by V6 (low penetrance).
CF1135 C. elegans egl-20(n585) IV; muEx68. Show Description
muEx68 [(pJW33) myo-2p::egl-20::GFP + (7PD10.46) unc-22 (antisense)]. Use nicotine or levamisole to pick twitchers. Reference: Whangbo J & Kenyon C, (1999) Mol Cell 4(5):851-8.
CF1137 C. elegans daf-16(mu86) I; daf-2(e1370) III; muIs61. Show Description
muIs61 [daf-16a::GFP + rol-6(su1006)]. Temperature-sensitive. Maintain at 15 C. Rollers. Reference: Lin K, Hsin H, Libina N, Kenyon C. Nat Genet. 2001 Jun;28(2):139-45.
CF1139 C. elegans daf-16(mu86) I; muIs61. Show Description
muIs61 [(pKL78) daf16::GFP + rol-6(su1006)]. muIs61 rescues daf-16(mu86). muIs61 is a gamma-induced insertion of muEx50. muIs61 insertion point has not been mapped.
CF1170 C. elegans egl-20(n585) IV; muEx79. Show Description
muEx79 [(pJW33) myo-2p::egl-20::GFP + (7PD10.46) unc-22 (antisense)]. Use nicotine or levamisole to pick twitchers. Reference: Whangbo J & Kenyon C, (1999) Mol Cell 4(5):851-8.
CF1192 C. elegans egl-27(n170) II; muIs35 V. Show Description
muIs35 [mec-7::GFP + lin-15(+)].
CF12 C. elegans rol-6(e187) II; lin-22(n372) IV; him-5(e1490) V. Show Description
Rollers. lin-22 and him-5 mutations affect neuroblast formation from epidermal precursor cell V5.
CF1259 C. elegans mig-13(mu225) lin-15B&lin-15A(n765) X; muIs62. Show Description
muIs62 [mig-13p::mig-13::GFP + lin-15(+)].
CF1295 C. elegans daf-16(mu86) I; daf-2(e1370) III; muEx108. Show Description
muEx108 [(pKL99-2) daf-16::GFP/daf16bKO + rol-6(su1006)]. Grows okay at 20C. Rollers should form dauers at 25C. Pick Rollers to maintain.
CF1308 C. elegans daf-16(mu86) I; muEx116. Show Description
muEx116 [daf-16a::GFP(T54A S240A T242A S314A) + rol-6(su1006)]. Grows at all temperatures. Carries extrachromosomal array. Pick Rollers to maintain.
CF1330 C. elegans daf-16(mu86) I; muEx128. Show Description
muEx128 [(pKL79) daf-16a::GFP) + rol-6(su1006)]. Grows okay at 20C. Pick Rollers to maintain.
CF1371 C. elegans daf-16(mu86) I; muEx151. Show Description
muEx151 [(pKL106-8) daf-16aAM::GFP/bKO + rol-6(su1006)]. Grows okay at 20C. Pick Rollers to maintain.
CF1380 C. elegans daf-16(mu86) I; daf-2(e1370) III; muEx158. Show Description
muEx158 [daf-16cAM::GFP + sur-5p::GFP] (AM = AKT-site mutant). Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less. muEx158 contains GFP-tagged daf-16 c isoform (described as a1 isoform in Lin, et al. Nat Genet. 2001) with 4 Ser/Thr residues mutated to Ala, which completely rescues dauer formation and partially restores longevity of daf-16; daf-2 double mutants. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.
CF1395 C. elegans ceh-20(mu290) III; muIs164. Show Description
muIs164 [tax-4::GFP].
CF1407 C. elegans daf-16(mu86) I; muIs71 X. Show Description
muIs71 [(pKL99) daf-16ap::GFP::daf-16a(bKO)) + rol-6(su1006)]. Grows okay at 20C. Spontaneous integrant. Rollers.
CF1442 C. elegans daf-16(mu86) I; daf-2(e1370) III; muEx169. Show Description
muEx169 [unc-119p::GFP::daf-16 + rol-6(su1006)]. Pick Rollers to maintain. May grow better at 15C.
CF1449 C. elegans daf-16(mu86) I; daf-2(e1370) III; muEx176. Show Description
muEx176 [daf-16p::GFP::daf-16 + rol-6(su1006)]. Pick rollers to maintain -- Low transmission rate! Maintain at 15C. Forms dauers at 25C. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.
CF1514 C. elegans daf-16(mu86) I; daf-2(e1370) III; muEx211. Show Description
muEx211[pNL213(ges-1p::GFP::daf-16) + rol-6(su1006)]. Grows at 15C (probably also at 20C). Pick Rollers to maintain.
CF1515 C. elegans daf-16(mu86) I; daf-2(e1370) III; muEx212. Show Description
muEx212[pNL212(myo-3p::GFP::daf-16) + rol-6(su1006)]. Grows at 15C (probably also at 20C). Pick Rollers to maintain.
CF1553 C. elegans muIs84. Show Description
muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. Green expression in head, tail and around vulva. Many animals roll weakly or not at all, but still express GFP. Grows at all temperatures.
CF1580 C. elegans daf-2(e1370) III; muIs84. Show Description
muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. Green expression in head, tail and around vulva. Daf-C at 25C. Grows well at 20C.
CF1588 C. elegans daf-16(mu86) I; daf-2(e1370) III; muIs84. Show Description
muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. Dim green expression in head, tail and around vulva. Daf-d. Can grow at 20C.
CF1595 C. elegans daf-16(mu86) I; daf-2(e1370) III; muEx227. Show Description
muEx227 [(pNL213) ges-1p::GFP::daf-16) + rol-6(su1006)]. Pick Rollers to maintain.
CF162 C. elegans mig-2(mu28) X. Show Description
mig-2 null mutation. Animals look grossly WT but Q descendants and other migratory neurons misplaced.
CF1632 C. elegans unc-62(mu232) muIs35 V. Show Description
muIs35 [mec-7::GFP + lin-15(+)]. Egl. GFP+. QR pax migration defect.
CF1641 C. elegans qid-6(mu252) III. Show Description
QL descendants migrate anteriorly. Bli. Unc. Weak Dpy.
CF1660 C. elegans daf-16(mu86) I; daf-2(e1370) III; muIs84; muEx211. Show Description
muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. muEx211 [ges-1p::daf-16::GFP + rol-6(su1006)]. Pick Rollers to maintain. Partial rescue of lifespan phenotype. Some animals show variable daf-16 expression in the intestine. Grows okay at 15C. [NOTE: muEx211 is quite unstable. Be sure to pick Rollers to avoid losing the array.]
CF1665 C. elegans muIs32 II; mig-15(mu327) X. Show Description
muIs32 [mec-7p::GFP + lin-15(+)]. QL descendants migrate anteriorly; defects in HSN migration, male tail formation and PLM axon outgrowth. Egl. Unc. Pvl. Weak Dpy.
CF1667 C. elegans mig-15(mu342) X. Show Description
QL descendants migrate anteriorly; defects in HSN migration, male tail formation and PLM axon outgrowth. Egl. Unc. Pvl. Weak Dpy.
CF1700 C. elegans daf-16(mu86) I; mes-1(bn7) X; muEx248. Show Description
muEx248 [(pNL209) daf-16::GFP::daf-16(cDNA) + podr-1::RFP]. Pick green (body) / red (head neurons) animals. Transmission efficiency ~50%. Can be grown at 20C with some sterility (30-50%). The higher the temperture, the greater the sterility.
CF1724 C. elegans daf-16(mu86) I; daf-2(e1370) III; muIs105. Show Description
muIs105 [daf-16p::GFP::daf-16 + rol-6(su1006)]. Rollers; Rol phenotype is not always evident). Integrated line derived from CF1449. Maintain at 15C. Forms dauers at 25C. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.
CF1756 C. elegans ptp-3(mu245) muIs32 II. Show Description
muIs32 [mec-7p::GFP + lin-15(+)]. QL descendants migrate anteriorly.
CF1806 C. elegans ceh-20(mu290) III; muEx261. Show Description
muEx261[ceh-20::GFP at C terminus + odr-1::RFP].
CF1814 C. elegans rrf-3(pk1426) II; daf-2(e1370) III. Show Description
Daf-c at 25.5C; grow at 20C or less. Long lived.
CF1824 C. elegans muEx265. Show Description
muEx265 [hsf-1p::hsf-1(cDNA) + myo-3::GFP]. Pick GFP worms to maintain.
CF1827 C. elegans daf-16(mu86) I; daf-2(e1370) III; muEx268. Show Description
muEx268 [ges-1p::GFP::daf-16(cDNA) + odr-1::RFP]. daf-16 GFP expressed in intestine. Partial rescue of lifespan phenotype. Grows okay at 15C. Pick RFP to maintain.
CF1844 C. elegans rrf-3(b26) II; daf-2(mu150) III; fem-1(hc17) IV. Show Description
Long lifespan. Maintain at 15C. Worms develop slowly at 20C, and are sterile at 25C. Reference: Garigan D, et al. Genetics. 2002 Jul;161(3):1101-12.
CF1864 C. elegans daf-10(mu377) IV. Show Description
Temperature-sensitive allele of daf-10 exhibits dye filling (Dyf) phenotype at 25C and non-Dyf at 20C.
CF1874 C. elegans daf-16(mu86) I; muIs84. Show Description
muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]. Green expression in head, tail and around vulva.
CF1880 C. elegans daf-16(mu86) I; glp-1(e2141) III. Show Description
Sterile at 25C; grow at 20C or less. glp-1(e2141) longevity suppressed by daf-16(mu86).
CF1903 C. elegans glp-1(e2144) III. Show Description
Temperature sensitive. Sterile at 25C. Maintain at 15C. [NOTE: CF1903 carries glp-1(e2144), not e2141 as previously described.]
CF1935 C. elegans daf-16(mu86) I; glp-1(e2141) III; muIs109. Show Description
muIs109 [daf-16p::GFP::DAF-16 cDNA + odr-1p::RFP]. Sterile at 25C; grow at 20C or less.