Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
MLC1777 C. elegans vha-1(luc132) III. Show Description
vha-1 gain-of-function allele created by replacing the miR-1 binding site (ACATTCCA) in the 3' UTR of the endogenous locus with a NotI (GCGGCCGC) restriction site. Reference: Gutiérrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
VC269 C. elegans sqv-3&vha-1(ok513)/eT1 III; +/eT1 V. Show Description
R10E11.8. Heterozygotes are WT and segregate WT, Unc-36 eT1 homozygotes, arrested eT1 aneuploid progeny, and homozygous ok513 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
MLC2230 C. elegans vha-1(luc161) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP, arrested hT2 aneuploids, and non-GFP luc161 homozygotes (embryonic lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. vha-1(luc161) is a 454 bp deletion removing most of the coding sequence. Reference: Gutiérrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
MLC1843 C. elegans vha-14(luc138) vha-1(luc132) III; vha-11(luc130) vha-8(luc135) IV; vha-13(luc133) V; vha-12(luc139) X. Show Description
vha gain-of-function alleles created by replacing the miR-1 binding sites (ACATTCCA) in the 3' UTRs of the endogenous loci with a NotI (GCGGCCGC) restriction site. (vha-12 gain-of-function allele was created by replacing three miR-1 binding sites (ACATTCCA) with NotI (GCGGCCGC), BamHI (GGATCC), and EcoRI (GAATTC) restriction sites.) Referred as 6x-vhaNotI. Reference: Gutiérrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
BK36 C. elegans qpIs11 I; unc-119(ed3) III. Show Description
qpIs11 [vha-1p::GFP + unc-119(+)] I. Strong expression of GFP in the cytoplasm of the excretory canal cell (exc) and slightly less strong expression in the head mesodermal cell (hmc). Reference: Mattingly BC & Buechner M. Dev Biol. 2011 Nov 1;359(1):59-72.
CF4586 C. elegans muIs252 II; unc-119(ed3) III; vha-13(mu493[wrmScarlet11::vha-13]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged wrmScarlet11::vha-13 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
CF4616 C. elegans muIs252 II; unc-119(ed3) III; vha-13(muIs264[wrmScarlet11(x2)::vha-13]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Two tandem repeats of split-wrmScarlet11 inserted at the N-terminus of the endogenous VHA-13 locus; detectable in somatic tissues where wrmScarlet1-10 is present. Figure 4A from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
JR2750 C. elegans bli-6(sc16) unc-22(e66)/unc-24(e138) vha-17(w13) dpy-20(e2017) IV. Show Description
Pick wild type animals to maintain.
MLC1774 C. elegans vha-11(luc130) IV. Show Description
vha-11 gain-of-function allele created by replacing the miR-1 binding site (ACATTCCA) in the 3' UTR of the endogenous locus with a NotI (GCGGCCGC) restriction site. Reference: Gutiérrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
MLC1778 C. elegans vha-13(luc133) V. Show Description
vha-13 gain-of-function allele created by replacing the miR-1 binding site (ACATTCCA) in the 3' UTR of the endogenous locus with a NotI (GCGGCCGC) restriction site. Reference: Gutiérrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
MLC1779 C. elegans vha-14(luc134) III. Show Description
vha-14 gain-of-function allele created by replacing the miR-1 binding site (ACATTCCA) in the 3' UTR of the endogenous locus with a NotI (GCGGCCGC) restriction site. Reference: Gutiérrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
PHX1049 C. elegans vha-13(syb1049[GFP::vha-13]) V. Show Description
GFP inserted at N-terminus of endogenous vha-13 locus. GFP expression in the intestine and other tissues. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628.
PHX731 C. elegans vha-13(syb731[wrmScarlet::vha-13]) V. Show Description
wrmScarlet inserted at N-terminus of endogenous vha-13 locus. wrmScarlet expression in the intestine and other tissues. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628.
RB938 C. elegans vha-12(ok821) X. Show Description
F20B6.2. Homozygous. Outer Left Sequence: ACGCAGTAAGAAACGGCAAG. Outer Right Sequence: AGTACGGCGCATTGAACTTT. Inner Left Sequence: GCAGACAGCACTGCAAAAAG. Inner Right Sequence: GAGTGGTGGTGATGGTGATG. Inner Primer WT PCR product: 2135. Deletion size: 1145 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG3115 C. elegans vha-11(ve615[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25 [unc-5(tm9708)]. Show Description
Homozygous Emb. Deletion of 5698 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, non-GFP unc-5(tm9708) homozygotes, and GFP+ dead embryos(ve615).
RG3128 C. elegans +/mT1[umnIs52] II; vha-14(ve628[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 1453 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead larvae (ve628 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: atgtttttttcatagaaataacaaactttt ; Right flanking sequence: caccctccgatgttcttcctgttttctatg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3337 C. elegans vha-18(ve837[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1469 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTCAGCAGACGCATCATTGCTTCTTTACCA ; Right flanking sequence: TTTGAAACTGAATCAAAGAAAATTAACTTT. vha-18 sgRNA #1: CTTAAAGTGGAACAACTCGG; vha-18 sgRNA #2: CAGTTTCAAAATGGTATTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG5045 C. elegans +/nT1 [umnIs49] IV; vha-13(gk5758[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5758 homozygotes), Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VC4759 and CGC63. gk5758 is a 2243 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCCAGGAAAAGATGGCCGCAGAATCTTCG; Right flanking sequence: CGCTAGATTCTGTTCAGTTTTGCTGAGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
SD1485 C. elegans ccIs4251 I; gaIs211. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. gaIs211 [vha-12p::his-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009) 139(6).
VC1831 C. elegans vha-16(ok2332) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C30F8.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2332 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCAGATCCAGGAAGGAATGA. External right primer: CGAAAATAATTGCAGCCCAT. Internal left primer: TTGCGAAGCCGATTTAGTTT. Internal right primer: TTCTTTCGCCTCCTTTTTCA. Internal WT amplicon: 2112 bp. Deletion size: 831 bp. Deletion left flank: TTTCGAAAAACCAGGCCGTAAACTGACAGC. Deletion right flank: TTTTTTTTCAAATTAAATTATTATACAACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4620 C. elegans vha-10(gk5690[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 714 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGAGAGGGATATCACATCATAAAAGTAAGG. Right flanking sequence: GTTTGTGAGGCCATTTTAAGGTTTTCGGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4689 C. elegans vha-13(gk5758[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. Show Description
[NOTE: Please see RG5045 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2243 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTCCAGGAAAAGATGGCCGCAGAATCTTCG. Right flanking sequence: CGCTAGATTCTGTTCAGTTTTGCTGAGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.