Search Strains

juIs76 [unc-25p::GFP + lin-15(+)] II. Unc. Maintain at 15C. Synthetic Lethality at 25C.

Maintain at 15C. Synthetic Lethality at 25C. Unc; almost paralyzed. Growth slow.

Maintain at 15C. Synthetic Lethality at 25C.

Maintain at 15C. Synthetic Lethality at 25C.

Maintain at 15C. Synthetic Lethality at 25C.

Small. Recessive. Male spicules abnormal. M-MATING-NO SUCCESS. Synthetic lethal common.

Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP cer140 gk401 homozygotes (synthetic sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. Generated by CRISPR-mediated deletion of ubh-4 in gk401 mutant background. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270

gsgIs1 [synthetic 900 bp HA1 left::dpy-10 cRNA site:: synthetic 900 bp HA2 right] (IV: 5014948). Superficially wild-type. gsgIs1 can be used to generate single-copy insertions in C. elegans Chromosome IV. This strain is part of the SKI PLACE System, which can be used to generate single-copy insertions into the C. elegans genome at specific safe harbor locations on each chromosome through CRISPR-Cas9-mediated insertion. The system uses a single plasmid, pSKI (Addgene #232484), to insert transgenes at specific genomic locations. Generated in N2 background. Reference: Dinneen E, et al. G3 (Bethesda). 2025 Sep 19:jkaf220. doi: 10.1093/g3journal/jkaf220. PMID: 40973646.

gsgIs2 [synthetic 900 bp HA1 left::dpy-10 cRNA site:: synthetic 900 bp HA2 right] (I: 2850968). Superficially wild-type. sgIs2 can be used to generate single-copy insertions in C. elegans Chromosome I. This strain is part of the SKI PLACE System, which can be used to generate single-copy insertions into the C. elegans genome at specific safe harbor locations on each chromosome through CRISPR-Cas9-mediated insertion. The system uses a single plasmid, pSKI (Addgene #232484), to insert transgenes at specific genomic locations. Generated in N2 background. Reference: Dinneen E, et al. G3 (Bethesda). 2025 Sep 19:jkaf220. doi: 10.1093/g3journal/jkaf220. PMID: 40973646.

gsgIs5 [synthetic 900 bp HA1 left::dpy-10 cRNA site:: synthetic 900 bp HA2 right] (III: 7007779). Superficially wild-type. gsgIs5 can be used to generate single-copy insertions in C. elegans Chromosome III. This strain is part of the SKI PLACE System, which can be used to generate single-copy insertions into the C. elegans genome at specific safe harbor locations on each chromosome through CRISPR-Cas9-mediated insertion. The system uses a single plasmid, pSKI (Addgene #232484), to insert transgenes at specific genomic locations. Generated in N2 background. Reference: Dinneen E, et al. G3 (Bethesda). 2025 Sep 19:jkaf220. doi: 10.1093/g3journal/jkaf220. PMID: 40973646.

gsgIs8 [synthetic 900 bp HA1 left::dpy-10 cRNA site:: synthetic 900 bpHA2 right] (X: 798667). Superficially wild-type. gsgIs8 can be used to generate single-copy insertions in C. elegans Chromosome X. This strain is part of the SKI PLACE System, which can be used to generate single-copy insertions into the C. elegans N2 genome at specific safe harbor locations on each chromosome through CRISPR-Cas9-mediated insertion. The system uses a single plasmid, pSKI (Addgene #232484), to insert transgenes at specific genomic locations. Generated in N2 background. Reference: Dinneen E, et al. G3 (Bethesda). 2025 Sep 19:jkaf220. doi: 10.1093/g3journal/jkaf220. PMID: 40973646.

gsgIs3 [synthetic 900 bp HA1 left::dpy-10 cRNA site:: synthetic 900 bp HA2 right] (II: 9834540). Superficially wild-type. gsgIs3 can be used to generate single-copy insertions in C. elegans Chromosome II. This strain is part of the SKI PLACE System, which can be used to generate single-copy insertions into the C. elegans genome at specific safe harbor locations on each chromosome through CRISPR-Cas9-mediated insertion. The system uses a single plasmid, pSKI (Addgene #232484), to insert transgenes at specific genomic locations. Generated in N2 background. Reference: Dinneen E, et al. G3 (Bethesda). 2025 Sep 19:jkaf220. doi: 10.1093/g3journal/jkaf220. PMID: 40973646.

gsgIs4 [synthetic 900 bp HA1 left::dpy-10 cRNA site:: synthetic 900 bp HA2 right] (V: 8644845). Superficially wild-type. gsgIs4 can be used to generate single-copy insertions in C. elegans Chromosome V. This strain is part of the SKI PLACE System, which can be used to generate single-copy insertions into the C. elegans N2 genome at specific safe harbor locations on each chromosome through CRISPR-Cas9-mediated insertion. The system uses a single plasmid, pSKI (Addgene #232484), to insert transgenes at specific genomic locations. Generated in N2 background. Reference: Dinneen E, et al. G3 (Bethesda). 2025 Sep 19:jkaf220. doi: 10.1093/g3journal/jkaf220. PMID: 40973646.

sup-35 rescues synthetic lethality of ubc-18 and pha-1.

sup-36 suppresses synthetic lethality and Pun phenotype of ubc-18(tm5426) animals grown on ubc-3 RNAi.

DLM 19: sup-37 suppresses synthetic lethality and Pun phenotype of ubc-18(tm5426) animals grown on ubc-3 RNAi.

Heterozygotes are WT and GFP+. mIn1 homozygotes are Dpy and GFP+. vab-1; sax-3 homozygotes are synthetic lethal.

Synthetic Daf at 15C when in an unc-31(e169) background.

Synthetic dauer-constitutive with unc-31(e169) or unc-3(e151). Defective in adaptation to benzaldehyde, isoamyl alcohol, and butanone. Normal in adaptation to diacetyl and 2-methylpyrazine. Normal in chemotaxis to volatile and water-soluble chemicals.

Synthetic dauer-constitutive with unc-31(e169) or unc-3(e151). Defective in adaptation to benzaldehyde, isoamyl alcohol, and butanone. Normal in adaptation to diacetyl and 2-methylpyrazine. Normal in chemotaxis to volatile and water-soluble chemicals.

mScarlet::3xMyc tag inserted at the C-terminus of the endogenous spe-44 locus by CRISPR. Allele obtained using the self-excising cassette, following Dickinson et al, 2015 method. SEC was excised; there is a lox511I in the synthetic intron left by the excision. Reference: Ragle JM, et al. Development. 2020 Nov 27;147(22):dev193862. doi: 10.1242/dev.193862. PMID: 33060131.

mScarlet::TEV::AID*::3xFLAG tag inserted at the C-terminus of the endogenous spe-44 locus by CRISPR. Insertion includes a flexible 30 amino acid linker between SPE-44 and mScarlet and was produced by SEC excision. Strain contains a lox511I site in a synthetic intron. Reference: Ragle JM, et al. Development. 2020 Nov 27;147(22):dev193862. doi: 10.1242/dev.193862. PMID: 33060131.

No visible phenotype except for reduced brood size. Synthetic sterile with nos-2(RNAi). 1176 bp deletion starting at aa 58 in nos-1 ORF and ending 414 bp past the end of the nos-1 ORF.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujEx173 [ceh-36::TY1::eGFP::3xFLAG + unc-119(+)]. ujEx173 rescues unc-36, suppressing synthetic lethality in animals carrying the array. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003.

Overall healthy but reduced brood size and pharyngeal pumping rate. Synthetic lethal with emr-1(-). ca19 is a Leu to Arg mutation at position 16 of LEM-2, reconstituting a mutation in the American Hutterite Population that causes juvenile cataracts and premature cardiomyopathy.

Synthetic Roller after L4 stage (85% penetrance). je5 is dominant and je11 is recessive. See 1996 East Coast Worm Meeting Abstract #80.

cp78[gfp::hmp-2 + LoxP] III. GFP inserted at the N terminus of endogenous hmp-2 gene by Cas9-triggered homologous recombination. Floxed unc-119 selection cassette was subsequently removed by Cre/Lox recombination leaving a LoxP scar in the second synthetic intron of GFP. Green fluorescence in early embryos, larvae, and adults. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.

Animals are healthy and Unc. Synthetic lethal/hyperproliferation with lin-35.

Synthetic lethal with lin-35(n745). Temperature sensitive. Grow at 15 C.

WT phenotype. Synthetic Muv.

WT. Synthetic Muv with lin-8 or lin-38.

Superficially wild-type. Synthetic Muv with lin-15A(n767).

Double mutant is Muv. lin-35 alone is non-Muv. lin-35 is a class B synthetic Muv.

Synthetic Muv. n749 is lin-15 Class A allele.

Double mutant is Multivulva. lin-38 alone is non-Muv. lin-38 is a class A synthetic Muv.

WT phenotype. Synthetic Muv.

WT. Synthetic Muv with lin-8, lin-38 or lin-15(n767).

Synthetic Muv.

Dpy. n833 is a synthetic Muv with lin-15A(n767).

Synthetic Muv B.

Synthetic Muv. n433 is lin-15 Class A allele.

Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.

CRISPR/Cas9 insertion of mNeonGreen into the endogenous unc-52 locus in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.

Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC.

Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC.

Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC.

Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC.

Suppresses sterility of lin-3(n1058) and let-23(sy10). Not involved in vulva development. Synthetic sterile in combination with lfe-2(sy326). Previously called lfe-1. Do not distribute this strain; other labs should request it from the CGC.

fxIs10 [synthetic guide site::(delta)HygR::unc-54 3' UTR::LoxP, II:8420157]. fxIs10 is a CRISPR-engineered site for future transgene insertion via CRISPR utilizing a synthetic guide site (GGACAGTCCTGCCGAGGTGGAGG?) with a split hygromycin resistance selection marker; fxIs10 also introduced a small deletion of genomic sequence at the insertion site (II:8420158-8420207). Reference: Stevenson ZC, et al. G3 (Bethesda). 2020 Oct 5;10(10):3775-3782. doi: 10.1534/g3.120.401400. PMID: 32816924

fxSi8 [synthetic guide site1::3'(delta)HygR::unc-54 3' UTR::LoxN (I:2851003)]. fxSi8 is a CRISPR-engineered site in the N2 background for future transgene insertion via CRISPR utilizing a synthetic guide site (GTTTGAGTAGAGCACTCAGGAGG) with a split hygromycin resistance selection marker; fxSi8 also introduced a small deletion of genomic sequence at the insertion site (I:2851004-2851014).