Search Strains

More Fields
Strain Species Genotype Add
CB1002 C. elegans flu-1(e1002) V. Show Description
Increased gut fluorescence, bluish purple. M-MATING++ 1-10%WT. Semi-dominant.
RG3502 C. elegans madf-11(ve1002[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)] III. Mel. Deletion of 2623 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) adults that give progeny that die early (ve1002 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: AAAGTTAAATATTGATGTTGAAGTTTGCCT; Right flanking sequence: ATTTTTAATAATAATTCTGAAATTTATTTT. madf-11 crRNA A: GTTCCCATTGAAAAATCACC; madf-11 crRNA B: TTCCAATGAGCGACCGACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
XE1002 C. elegans unc-70(s1502) V; oxIs12 X. Show Description
oxIs12 [unc-47p::GFP + lin-15(+)]. Unc. Reference: Hammarlund M, et al. J Cell Biol. 2000 May 15;149(4):931-42. [NOTE: this strain grows very slowly and will take longer than usual to prepare for shipping.]
AGK192 C. elegans unc-119(ed3) III; zdIs13 IV; armIs5. Show Description
zdIs13 [tph-1p::GFP] IV. armIs5 [zfp-1(fosmid)::FLAG + unc-119(+)]. Integrated zfp-1 transgene expressed in the germline. Fosmid-based zfp-1::FLAG transgene fully rescues stress-sensitivity and reduced lifespan in zfp-1(ok554) homozygotes. ChIP with anti-FLAG antibody detects ZFP-1::FLAG localization to promoters of highly expressed genes. References: Mansisidor AR, et al. PLoS Genet. 2011 Sep;7(9):e1002299. Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015. Cecere G, et al. Mol Cell. 2013 Jun 27;50(6):894-907.
AGK26 C. elegans unc-119(ed3) III; armEx5. Show Description
armEx5 [zfp-1(fosmid)::GFP + unc-119(+)]. Pick non-Unc to maintain. Fosmid-based zfp-1::GFP transgene fully rescues stress-sensitivity and reduced lifespan in zfp-1(ok554) homozygotes. Nuclear expression of zfp-1::GFP is observed ubiquitously in somatic cells in all developmental stages; high levels of GFP expression is observed in oocytes with lower levels of expression in the distal germline. References: Mansisidor AR, et al. PLoS Genet. 2011 Sep;7(9):e1002299. Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015.
ALF4 C. elegans unc-119(ed3) III; daf-12(rh61rh411) X; bafIs4. Show Description
bafIs4 [daf-12 (fosmid) + unc-119(+)]; rescues both daf-12 and unc-119. Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179.
ALF62 C. elegans bafIs62. Show Description
bafIs62 [lin-42p::GFP + unc-119(+)]. lin-42p::GFP reporter consists of 2 kb upstream of lin-42a isoform subcloned into modified pPD95.75 vector also carrying unc-119(+). Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179.
ALF63 C. elegans unc-119(ed3) III; bafIs63. Show Description
bafIs63 [lin-42p(mut)::GFP + unc-119(+)]. lin-42p(mut)::GFP reporter consists of 2 kb upstream of lin-42a isoform subcloned into modified pPD95.75 vector also carrying unc-119(+); all potential DAF-12 binding sites have been mutated. Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179.
ALF82 C. elegans unc-119(ed3) III; daf-12(rh61rh411) X; bafIs62. Show Description
bafIs62 [lin-42p::GFP + unc-119(+)]. lin-42p::GFP reporter consists of 2 kb upstream of lin-42a isoform subcloned into modified pPD95.75 vector also carrying unc-119(+). Array was crossed into strain ALF3 to create ALF82. Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179.
ALF9 C. elegans unc-119(ed3) III; daf-12(rh61rh411) X; bafIs9. Show Description
bafIs9 [daf-12::TAP (fosmid) + unc-119(+)]; rescues both daf-12 and unc-119. TAP tag inserted into daf-12 fosmid. Reference: Hochbaum D, et al. PLoS Genet. 2011 Jul;7(7):e1002179.
BR5082 C.elegans shc-1(ok198) I; zIs356 IV. Show Description
zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)] IV. Tumorous germline with degeneration of surrounding extracellular matrix & disrupted gonadal basement membrane. Reference: Qi W, et al. PLoS Genet. 2012;8(8):e1002836. doi: 10.1371/journal.pgen.1002836.
GA631 C. elegans lin-15B&lin-15A(n765) X; wuIs177. Show Description
wuIs177 [ftn-1p::GFP + lin-15(+)]. GFP expression in the intestine. ftn-1p::GFP transgene shows moderate basal expression under standard culture conditions in an otherwise wild-type background, but is strongly induced by reduced insulin/IGF-1 signalling, reduced HIF signalling, and increased free iron levels. References: Ackerman D & Gems D. PLoS Genet. 2012;8(3):e1002498. Valentini S, et al. Mech Ageing Dev. 2012 May;133(5):282-90.
GR1719 C. elegans unc-119(ed3) III; mgSi3 IV. Show Description
mgSi3 [(pCMP2)ubl-1p::GFP::ubl-1-3'UTR + Cbr-unc-119(+)] IV. Strong ubiquitous GFP expression. Can be used as a control for a strain containing an endogenous siRNA sensor (GR1720). Reference: Montgomery TA, et al. PLoS Genet. 2012;8(4):e1002616.
GR1720 C. elegans unc-119(ed3) III; mgSi4 IV. Show Description
mgSi4 [(pCMP2)ubl-1p::GFP::siR-1-sensor-ubl-1-3'UTR + Cbr-unc-119(+)] IV. Very weak ubiquitous GFP expression. The 22G siR-1 sensor transgene is more sensitive to gene inactivations that affect 22G siR-1 levels when grown at 25C compared to 20C. Reference: Montgomery TA, et al. PLoS Genet. 2012;8(4):e1002616.
HS1673 C. elegans lin-17(n3091) mom-5(ne12) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); vpIs1 X. Show Description
vpIs1 [elt-3::GFP + lin-15(+)] X. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n3091 homozygotes (Sys Unc Psa). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Yamamoto Y, et al. PLoS Genet. 2011 Oct;7(10):e1002308.
HS1675 C. elegans egl-20(n585) cwn-2(ok895) IV. Show Description
Egl. Unc. Reference: Yamamoto Y, et al. PLoS Genet. 2011 Oct;7(10):e1002308.
HS1749 C. elegans mig-1(e1787) lin-17(n671) mom-5(ne12) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Segregates WT GFP+ heterozygotes, non-GFP Unc Sys, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Yamamoto et al. PLoS Genet. 2011 Oct;7(10):e1002308.
HS1790 C. elegans mig-1(e1787) lin-17(n671) mom-5(ne12) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); cfz-2(ok1201) V. Show Description
mig-1 confirmed by complementation tests, and cfz-2 by PCR. Segregates WT GFP+ heterozygotes, non-GFP Unc Sys, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Yamamoto et al. PLoS Genet. 2011 Oct;7(10):e1002308.
HS2067 C. elegans mig-1(e1787) lin-17(n671) mom-5(ne12) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); cfz-2(ok1201) wIs51 V; lin-18(e620) X. Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Heterozygotes are GFP+(pharynx) wild-type and segregate GFP+(pharynx) wild-type, GFP-(pharynx) Sys Psa Unc and dead eggs. PIck GFP+(pharynx) wild-type to maintain. Presence of cfz-2 was confirmed by PCR; mig-1 by complementation test. Reference: Yamamoto Y, et al. PLoS Genet. 2011 Oct;7(10):e1002308.
HS2326 C. elegans cwn-1(ok546) II; egl-20(n585) cwn-2(ok895) IV/nT1 [qIs51] (IV;V); vpIs1 X. Show Description
vpIs1 [elt-3::GFP + lin-15(+)] X. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok546 homozygotes (Unc Egl). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Yamamoto Y, et al. PLoS Genet. 2011 Oct;7(10):e1002308.
HS2329 C. elegans unc-76(e911) V; osEx397. Show Description
osEx397 [cwn-1p::cwn-1::Venus + unc-76(+)]. Pick nonUnc to maintain. Transgene is expressed in tail region. Reference: Yamamoto et al. PLoS Genet. 2011 Oct;7(10):e1002308.
HS2332 C. elegans unc-76(e911) V; osEx393. Show Description
osEx393 [cwn-2p::cwn-2::Venus + unc-76(+)]. Pick nonUnc to maintain. Transgene is expressed in the pharynx. Reference: Yamamoto et al. PLoS Genet. 2011 Oct;7(10):e1002308.
HS2372 C. elegans mig-1(e1787) I; cfz-2(ok1201) wIs51 V; lin-18(e620) X. Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Bivulva. Presence of cfz-2 was confirmed by PCR. mig-1 and lin-18 were confirmed by sequencing. Reference: Yamamoto Y, et al. PLoS Genet. 2011 Oct;7(10):e1002308.
KP2048 C. elegans ric-7(nu447) V. Show Description
Reference: Hao Y, et al. PLoS Genet. 2012 Jan;8(1):e1002464.
LE3078 C. elegans lqEx631. Show Description
lqEx631 [tiam-1::CFP + str-1::GFP]. GFP expression in AWB amphid neurons. CFP neural expression in the head and tail, the ventral cord commissural motorneurons, the mechanosensory neurons (ALMs, PLMs, AVM, PVM) and the CAN, PDE, and PVD neurons. Reference: Demarco RS, et al. PLoS Genet. 2012;8(4):e1002665.
LE3190 C. elegans tiam-1(tm1556) I; juIs76 II; mig-2(mu28) lqIs2 X. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. lqIs2 [osm-6::GFP] X. lqIs2 carries a PDE/amphid/phasmid marker linked to mig-2. Reference: Demarco RS, et al. PLoS Genet. 2012;8(4):e1002665.
LE3191 C. elegans tiam-1(tm1556) I; juIs76 II; ced-10(n1993) lqIs3 IV. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. lqIs3 [osm-6::GFP] IV. lqIs3 carries a PDE/amphid/phasmid marker linked to ced-10. Reference: Demarco RS, et al. PLoS Genet. 2012;8(4):e1002665.
LE3192 C. elegans tiam-1(ok772) I; juIs76 II; mig-2(mu28) lqIs2 X. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. lqIs2 [osm-6::GFP] X. lqIs2 carries a PDE/amphid/phasmid marker linked to mig-2. Reference: Demarco RS, et al. PLoS Genet. 2012;8(4):e1002665.
LE3193 C. elegans tiam-1(ok772) I; juIs76 II; ced-10(n1993) lqIs3 IV. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. lqIs3 [osm-6::GFP] IV. lqIs3 carries a PDE/amphid/phasmid marker linked to ced-10. Reference: Demarco RS, et al. PLoS Genet. 2012;8(4):e1002665.
MT14728 C. elegans mfap-1(n4564 n5214) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP mfap-1 homozygotes. Pick WT GFP and check for correct segregation of progeny to maintain. mfap-1(n4564 n5214) mutants exhibit temperature-sensitive lethality: at 15°C, (n4564 n5214) homozygous animals grow and behave similarly to wild-type; at 20°C mutant animals grow more slowly, have few progeny and are hyperactive; at 25°C the mutant strain is embryonically lethal. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Ma L, et al. PLoS Genet. 2012;8(7):e1002827.
OH7805 C. elegans otIs204. Show Description
otIs204 [ceh-36p2::lsy-6 + elt-2p::GFP]. Reference: Poole RJ, et al. PLoS Genet. 2011 June; 7(6): e1002109.
OU100 C. elegans prkl-1(zy11) IV. Show Description
Reference: Sanchez-Alvarez L, et al. PLoS Genet. 2011 Sep;7(9):e1002257.
OU247 C. elegans zyIs1. Show Description
zyIs1 [lin-11::RFP + rol-6(su1006)]. Roller. Reference: Sanchez-Alvarez L, et al. PLoS Genet. 2011 Sep;7(9):e1002257.
SD1655 C. elegans unc-119(ed3) III; gaEx189. Show Description
gaEx189 [sod-3p::mCherry + lys-1p::lyz(D. rerio) + unc-119(+)]. Reference: Sagi D & Kim SK. PLoS Genet. 2012 Jun;8(6):e1002780.
SD1658 C. elegans unc-119(ed3) III; gaEx192. Show Description
gaEx192 [sod-3p::mCherry + ucp-4p::ucp2(D. rerio) + unc-119(+)]. Reference: Sagi D & Kim SK. PLoS Genet. 2012 Jun;8(6):e1002780.
SD1821 C. elegans unc-119(ed3) III; gaEx231. Show Description
gaEx231 [imp-2(+) + sod-3p::mCherry + unc-119(+)]. Pick mCherry+ non-Unc to maintain. Long-lived. Over-expression of IMP-2. Reference: Sagi D and Kim SK. PLoS Genet. 2012;8(6):e1002780.
SD1822 C. elegans unc-119(ed3) III; gaEx229. Show Description
gaEx229 [hsf-1(+) + sod-3p::mCherry + unc-119(+)]. Pick mCherry+ non-Unc to maintain. Long-lived. Over-expression of HSF-1. Reference: Sagi D and Kim SK. PLoS Genet. 2012;8(6):e1002780.
SD1827 C. elegans unc-119(ed3) III; gaEx230. Show Description
gaEx230 [sod-3p::mCherry + unc-119(+)]. Pick mCherry+ non-Unc to maintain. Reference: Sagi D and Kim SK. PLoS Genet. 2012;8(6):e1002780.
SD1901 C. elegans unc-119(ed3) III; gaEx214. Show Description
gaEx214 [sod-3p::mCherry + aakg-2(sta2) + ucp-4p::ucp2(D. rerio) + unc-119(+)]. Reference: Sagi D & Kim SK. PLoS Genet. 2012 Jun;8(6):e1002780.
SD1902 C. elegans unc-119(ed3) III; gaEx216. Show Description
gaEx216 [sod-3p::mCherry + hsf-1(+) + lys-1p::lyz(D. rerio) + unc-119(+)]. Reference: Sagi D & Kim SK. PLoS Genet. 2012 Jun;8(6):e1002780.
SD1903 C. elegans unc-119(ed3) III; gaEx218. Show Description
gaEx218 [sod-3p::mCherry + aakg-2(sta2) + lys-1p::lyz(D. rerio) + ucp-4p::ucp2(D. rerio) + unc-119(+)]. Reference: Sagi D & Kim SK. PLoS Genet. 2012 Jun;8(6):e1002780.
SD1904 C. elegans unc-119(ed3) III; gaEx220. Show Description
gaEx220 [sod-3p::mCherry + aakg-2(sta2) + hsf-1(+) + lys-1p::lyz(D. rerio) + unc-119(+)]. Reference: Sagi D & Kim SK. PLoS Genet. 2012 Jun;8(6):e1002780.
SD1905 C. elegans unc-119(ed3) III; gaEx223. Show Description
gaEx223 [sod-3p::mCherry + aakg-2(sta2) + ucp-4p::ucp2(D. rerio) + hsf-1(+) + lys-1p::lyz(D. rario) + unc-119(+)]. Reference: Sagi D & Kim SK. PLoS Genet. 2012 Jun;8(6):e1002780.
STE68 C. elegans nhr-49(nr2041) I. Show Description
Reference: Pathare PP, et al. PLoS Genet. 2012 Apr;8(4):e1002645.
STE69 C. elegans nhr-66(ok940) IV. Show Description
Reference: Pathare PP, et al. PLoS Genet. 2012 Apr;8(4):e1002645.
STE70 C. elegans nhr-80(tm1011) III. Show Description
Reference: Pathare PP, et al. PLoS Genet. 2012 Apr;8(4):e1002645.
STE71 C. elegans nhr-13(gk796) V. Show Description
Reference: Pathare PP, et al. PLoS Genet. 2012 Apr;8(4):e1002645.
STE72 C. elegans nhr-80(tm1011) III; nhr-66(ok940) IV. Show Description
Reference: Pathare PP, et al. PLoS Genet. 2012 Apr;8(4):e1002645.
STE73 C. elegans nhr-80(tm1011) III; nhr-13(gk796) V. Show Description
Reference: Pathare PP, et al. PLoS Genet. 2012 Apr;8(4):e1002645.
SV1067 C. elegans unc-119(ed3) III; heSi45 IV. Show Description
heSi45 [mcm-4::mCherry + unc-119(+)] IV. This strain contains an S-phase marker that will express mCherry in all cells that undergo cell division, providing a useful alternative to BrdU and EdU staining that is suitable for live imaging. References: Korzelius J, et al. Dev Biol. 2011 Feb 15;350(2):358-69. Korzelius J, et al. PLoS Genet. 2011 Nov;7(11):e1002362.