Search Strains

osEx397 [cwn-1p::cwn-1::Venus + unc-76(+)]. Pick nonUnc to maintain. Transgene is expressed in tail region. Reference: Yamamoto et al. PLoS Genet. 2011 Oct;7(10):e1002308.

osEx393 [cwn-2p::cwn-2::Venus + unc-76(+)]. Pick nonUnc to maintain. Transgene is expressed in the pharynx. Reference: Yamamoto et al. PLoS Genet. 2011 Oct;7(10):e1002308.

wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Bivulva. Presence of cfz-2 was confirmed by PCR. mig-1 and lin-18 were confirmed by sequencing. Reference: Yamamoto Y, et al. PLoS Genet. 2011 Oct;7(10):e1002308.

osEx67 [psa-4::GFP + unc-76(+)]. Maintain by picking non-Unc. Reference: Sawa H, et al. Mol Cell. 2000 Sep;6(3):617-24.

osEx71 [psa-1::GFP + unc-76(+)]. Maintain by picking non-Unc. Reference: Sawa H, et al. Mol Cell. 2000 Sep;6(3):617-24.

Heterozygotes are WT and GFP+. Segregate GFP- sterile Unc Psa (phasmid socket absent), very rare homozygous hT2 glowing animals, and dead eggs. ceh-20(os39) animals show defects in asymmetric T cell division.

osEx158 [wrm-1::GFP + unc-76(+)]. Animals with the array are WT and GFP+. Animals which have lost the array are Unc and GFP-.

lpIs100 [tub-1::GFP + rol-6(su1006)]. Rollers. Reference: Mukhopadhyay A, et al. Cell Metab. 2005 Jul;2(1):35-42.

wwEx69 [ins-10p::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. Reference: Ritter AD, et al. Genome Res. 2013 Mar 28.

Egg-laying (Egl) defects and subsequent internal hatching of progeny (Bagging) in > 95% of animals. xe11 is a C-to-U point mutation in each of the endogenous let-7 complementary sites, LCS1 and LCS2 [I:C9,335,211T & I:C9,335,260T]. xe11 is a weak gain-of-function allele: mutation of two functionally relevant let-7 binding sites impairs repression by let-7 causing over-expression of LIN-41 in L4 stage animals. Reference: Ecsedi M, et al. Dev Cell. 2015 Feb 9;32(3):335-44. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Maintain at 15C. Temperature-sensitive: slow growth rate, reduced brood size. Resistant to Cry proteins. Isolated from EMS screen in N2 background. Reference: Kim YM, et al. PLoS Pathog. 2024 Oct 18;20(10):e1012611. doi: 10.1371/journal.ppat.1012611. PMID: 39423230.

Heterozygotes are WT and segregate WT, Sterile Dpys and Uncs. Unc worms produce only dead embyros due to strict maternal effect pod-1(ye11) mutation. Embryos from pod-1 homozygous hermaphrodites are osmotically sensitive and exhibit polarity defects.

muIs16 [mab-5::GFP]. Larval lethal at L3/L4 stage. Ectopic expression of GFP in the arrested sor-1 mutant homozygotes (L3 stage). NOTE: This allele is published as bp1, but has been curated in WormBase as bp_1 in order to differentiate it from the STS marker bP1.

bnIs1 [pie-1p::GFP::pgl-1 + unc-119(+)] I. Him; ~30% male. Accumulation of GFP::PGL-1 aggregates in somatic cells in embryos.

bpIs131 [sepa-1p::sepa-1::GFP + unc-76(+)]. Him. SEPA-1::GFP aggregates form in a temporal pattern. Diffuse SEPA-1::GFP is detectible in most cells at the comma stage and greatly diminished by the 2-fold stage. After hatching, cytoplasmic SEPA-1::GFP aggregates were found in a few unidentified cells in the head and tail regions and also in the intestine, especially in the anterior and posterior pairs of intestine cells. Reference: Tian Y, et al. Cell. 2010 Jun 11;141(6):1042-55.

bpIs37 [dcap-1p::dcap-1::DsRed + rol-6(su1006)]. Rollers. Translational DsRed reporter for the P body-specific marker dcap-1, which encodes the C. elegans ortholog of decapping complex component DCAP1. Low levels of expression are homogenously distributed in the cytoplasm at all stages of embryogenesis. Reference: Sun YY, et al. Protein Cell. 2011 Nov;2(11):918-39.

bpIs151 [sqst-1p::sqst-1::GFP + unc-76(+)]. Him. In wild-type embryos, sqst-1::GFP is very weakly expressed and diffusely localized in the cytoplasm. Reference: Tian Y, et al. Cell. 2010 Jun 11;141(6):1042-55.

bpIs88 [tia-1p::tia-1::GFP + dcap-1p::dcap-1::RFP + rol-6(su1006)]. Rollers. Rolling phenotype is more apparent when raised >20C. Reference: Sun YY, et al. Protein Cell. 2011 Nov;2(11):918-39.

bpIs90 [tia-1p::tia-1::GFP + rol-6(su1006)]. Rollers. Rolling phenotype is more apparent when raised >20C. TIA-1::GFP is homogenously distributed in the cytoplasm during embryogenesis. At larval stages, diffuse TIA-1::GFP signals are observed in seam cells and hypodermal cells. TIA-1::GFP forms distinct bodies, especially in seam cells and hypodermal cells, under stress conditions. Reference: Sun YY, et al. Protein Cell. 2011 Nov;2(11):918-39.

ijIs10 [cpr-5::GFP::lacZ + unc-76(+)]. Extra intestinal cells.

WT behavioral phenotype. Axon guidance defect in ceh-17 expressing neurons ALA and 4SIA. ceh-17 = D1007.1, a C. elegans paired homeodomain transcription factor, Phox2 orthologue. np1 is a molecular null. np1 is a 1353 bp deletion inculding 549 bp upstream of the initiator ATG and extending to the 5th codon of the homeodomain. [NOTE: Miyazaki, et al. (2022) report that this strain carries the fln-2(ot611) mutation in the background, and outcrossing the strain resulted in significantly reduced quiescence during lethargus.]

quEx128 [npr-9::GFP + rol-6(su1006)]. Maintain by picking Rollers. ZK455.3 is npr-9 and is expressed in AIB neuron.

Healthy and fertile but exhibit a lowly penetrant lethality, and a small but significant proportion of the mutants arrest as early larvae. Reference: Pujol N, et al. Curr Biol. 2001 Jun 5;11(11):809-21.

Mos1 transposon insertions: frP11: F31C3 (at position 26364) acacctggtaTCGGAGGAGCTGCCAAATGGCGTCCGACTT. frP12: F01E11 (at position 3748) acacctggtaCAATCGAAAATCATTGAAATCAGTTAACAG. frP13: Y38E10A (at position 40384) acacctggtaTAGCTAGAGGACTGTCCCGGTCTAAAATGA. frP14: F53A2 (at position 34332) acacctggtaTATTATAAAAGATGTATGAAATGTCGTGAA. Mos1 sequence is in lowercase.

Strain derived by outcrossing RB1547 two times to N2 to remove the lethal background mutation in RB1547. Reference: Dierking K, et al. Cell Host Microbe. 2011 May 19;9(5):425-35.

Maintain at 15C. At 25C, nr2013 homozygotes are not viable. At 15C, less than 10% of nr2013 homozygotes develop into adults that are marginally fertile, while the majority of worms arrest at different developmental stages and exhibit dramatic defects in morphogenesis. Reference: Pujol N, et al. Curr Biol. 2001 Jun 5;11(11):809-21.

frSi17 [mtl- 2p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi17 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in the intestine, making animals RNAi-deficient except for intestinal tissues. The frSi17 insertion can be detected using a primer within the mtl-2 promoter (jep1061: aacaaacgtgggatgtaacc) in combination with downstream primer in rde-1 (jep2817 tcatactcgtagtattcccg), producing a 786 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc. (jep3108 is not present in the frSi17 transgene) Reference: Watts JS, et al. G3 (Bethesda) 2020 Nov 5;10(11):4167-4176. PMID: 32943454

frSi21 [col-62p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi21 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in adult epidermal tissues, making animals RNAi-deficient except for hypodermal (skin) tissues from the young adult stage. The frSi21 insertion can be detected using a primer within the col-62 promoter (jep2245: caaaaaggcgggatgagcag) in combination with downstream primer in rde-1 (jep2817 tcatactcgtagtattcccg), producing a 965 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc (jep3108 is not present in the frSi21 transgene). Reference: Watts JS, et al. G3 (Bethesda) 2020 Nov 5;10(11):4167-4176. PMID: 32943454

No phenotype. Contains a 2063 bp deletion in the smf-1 locus (K11G12.4) from position 17016 to position 19079 on the K11G12 cosmid. eh5 was obtained from the Sanger Centre Knockout Service in strain HX104. Reference: Au C, et al. PLoS One. 2009 Nov 18;4(11):e7792.

Reference: Ohnishi N, et al. EMBO J. 2011 Apr 6;30(7):1376-88.

Reference: Ohnishi N, et al. EMBO J. 2011 Apr 6;30(7):1376-88.

njIs11[glr-3p::GFP + ges-1p::RFP]. RIA interneurons express soluble GFP.

Reference: Miyara A, et al. PLoS Genet. 2011 May;7(5):e1001384.

Reference: Miyara A, et al. PLoS Genet. 2011 May;7(5):e1001384.

nuIs5 [glr-1::GFP + glr-1::G(alpha)s(Q227L) V + lin-15(+)] V. Reference: Tehrani N, et al. (2014) PLoS One 9(11):e113060.

nuIs5 [glr-1::GFP + glr-1::G(alpha)s(Q227L) V + lin-15(+)] V. Reference: Tehrani N, et al. (2014) PLoS One 9(11):e113060.

nuIs5 [glr-1::GFP + glr-1::G(alpha)s(Q227L) V + lin-15(+)] V. Reference: Tehrani N, et al. (2014) PLoS One 9(11):e113060.

nuIs5 [glr-1::GFP + glr-1::G(alpha)s(Q227L) V + lin-15(+)] V. Reference: Tehrani N, et al. (2014) PLoS One 9(11):e113060.

RNAi-capable OP50 strain. Tetracycline & Chloramphenicol resistant. Uracil auxotroph. E. coli B. Biosafety Level: BSL-1. Standard OP50 (CGC) was rendered RNAi competent through two modifications by phage transduction. The OP50 RNase III (rnc) allele was replaced with the deletion allele (rnc14::?Tn10) found in HT115(DE3), and a genomically encoded IPTG-inducible T7 RNA polymerase (lacz?A::T7pol camFRT) was introduced. Reference: Neve IAA, et al. G3 (Bethesda). 2019 Nov 11. pii: g3.400741.2019.

Maintain at 20C. Improved survival at 37C. Dauer constitutive and longer lifespan at 28C. Reference: Hwang HY, et al. Front Genet. 2020 Oct 6;11:566948. doi: 10.3389/fgene.2020.566948. PMID: 33133151

Improvement in thermotolerance at 37C, though weaker than in null mutants. Longer lifespan than to tax-2(gk117937) null mutant. Higher frequency of dauer formation and survival at 28C than tax-2(gk117937) null mutant. Reference: Hwang HY, et al. Front Genet. 2020 Oct 6;11:566948. doi: 10.3389/fgene.2020.566948. PMID: 33133151

ufIs126 [flp-13p::acr-12::GFP + lgc-11::mCherry] V. ACR-12::GFP expression labels postsynaptic iAChRs in DD motor neurons. References: Philbrook A, et al. eLife. 2018 Jul 24;7:e35692. doi: 10.7554/eLife.35692. PMID: 30039797. Oliver D, et al. PLoS Genet. 2022 Jan 28;18(1):e1010016. doi: 10.1371/journal.pgen.1010016. PMID: 35089924. Alexander K, et al. bioRxiv 2022.10.21.512874; doi: https://doi.org/10.1101/2022.10.21.512874.

weIs11[unc-119(+) + TAC-1::GFP].

Heterozygotes are slow (weak) Uncs and segregate paralyzed Uncs and early larval lethals. Dead larvae (ut111 homozygotes) are short, 2-fold and have an irregular shape.

utEx33 [flr-1p::GFP + rol-6(su1006)]. Pick Rollers to maintain. GFP is localized exclusively to intestinal nuclei because of the nuclear localization signal and lack of FLR-1 membrane spanning domains. Reference: Take-uchi et al.: Proc Natl Acd Sci USA. 1998 Sep 29;95(20):11775-80, Take-uchi et al.: Mol Biol Cell. 2005 Mar;16(3):1355-65, Kobayashi et al.: Genes to Cells 2011 May;16(5):565-75.

Resistant to 400ug/ml NaF. Slow growth. Small brood size. Small and thin.

Homozygous viable. Deletion of 2532 bp in parental strain N2. Left flanking sequence: agtcaattcggaactccatgt; Right flanking sequence: tctacggtttaaacaactcctc. sgRNA #1: aacgggatctgttcatcaca; sgRNA #2: agtgtgaaacgcaacgtcta.

jcpEx2 [ced-1p::F58G11.6(genomic)::YFP::let-858 3'UTR + unc-119(+) + myo-2::GFP]. Maintain by picking GFP+. Individuals that lost the array produce only arrested embryos with spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.

jcpEx3 [ccz-1p::ccz-1(genomic)::YFP::let-858 3'UTR + unc-119(+) + pha-1(+)]. Array rescues lethality. Individuals that lost the array produce only arrested embryos with spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.

Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ccz-1 homozygotes (produce only arrested embryos with spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.