| CB538 |
C. elegans |
unc-1(e538) X. Show Description
Recessive. Kinker Unc.
|
|
| GS1214 |
C. elegans |
sel-12(ar171) unc-1(e538) X. Show Description
Egl. Unc. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| RG3038 |
C. elegans |
C26D10.3(ve538[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1301 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tctcgagtaattcgtatcctgcgaataaat ; Right flanking sequence: CAAGGAGAAGTGTGTGGAAGAGCGATGGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| SP1022 |
C. elegans |
mnDp65 (X;I); unc-1(e538) X. Show Description
WT.
|
|
| SP1023 |
C. elegans |
mnDp68 (X;f); unc-1(e538) X. Show Description
Strain throws WT and Uncs. Maintain by picking WT.
|
|
| SP1024 |
C. elegans |
mnDp70 (X;V); unc-1(e538) X. Show Description
WT strain.
|
|
| SP1025 |
C. elegans |
mnDp69 (X;I); unc-1(e538) X. Show Description
WT strain.
|
|
| SP1027 |
C. elegans |
mnDp66 (X;I); unc-1(e538) X. Show Description
WT strain.
|
|
| SP1031 |
C. elegans |
mnDp67 (X;I); unc-1(e538) X. Show Description
WT strain.
|
|
| SP1053 |
C. elegans |
mnDp71 (X;f); unc-1(e538) X. Show Description
Strain throws WT and Uncs. Maintain by picking WT.
|
|
| SP1085 |
C. elegans |
mnDp73 (X;f); unc-1(e538) X. Show Description
Strain throws WT and Uncs.
|
|
| SP934 |
C. elegans |
unc-1(e538) dpy-3(e27) X. Show Description
DpyUnc.
|
|
| SP940 |
C. elegans |
unc-52(e444) II; unc-1(e538) X; mnDp11 (II;X;f). Show Description
Maintain strain by picking WT. Throws WT and Unc.
|
|
| SP965 |
C. elegans |
mnDp63 (X;I); unc-1(e538) X. Show Description
WT phenotype.
|
|